Labshake search
Citations for New England Biolabs :
3601 - 3650 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Polymerase chain reactions (PCR) for cloning steps were performed with Phusion High Fidelity polymerase (New England Biolabs). KHNYN-2 (NM_001290256 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCRs for new constructs were performed using Q5 High Fidelity polymerase (New England Biolabs, Ipswich, Massachusetts, USA), and analytic PCRs were performed using DNA AmpliTools Green Master Mix (BioTools ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50μL of the completed PCR reaction mixture was then digested with 2.5μL Dpn1 and 5.8μL CutSmart® Buffer (New England Biolabs) for 3h at 37°C to degrade methylated template DNA ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products and expression plasmid pJN105 (Newman and Fuqua, 1999) were digested with EcoRI and SacI (NEB) for 37°C for 1 hr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR was carried out using Phusion® or Phusion U High-Fidelity DNA Polymerase (New England Biolabs) according manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Ligation and phosphorylation of PCR products were performed simultaneously using T4 DNA ligase (New England Biolabs, M0202L) and T4 Polynucleotide Kinase (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (kind gift from Jonathan Abraham lab) ...
-
bioRxiv - Systems Biology 2020Quote: SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (gift of Jonathan Abraham) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR amplifications were carried out with the Q5® High-Fidelity DNA Polymerase (New England Biolabs) following the protocol recommended by the manufacturer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR reaction were carried out using the Q5® High-Fidelity DNA Polymerase (New England Biolabs) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... An 8.9 kb fragment preceding and including exon 5 was amplified by PCR (Phusion DNA Polymerase, NEB) and cloned into a plasmid encoding both a floxed neomycin resistance cassette and a diphtheria toxin negative selection marker ...
-
bioRxiv - Cell Biology 2020Quote: ... GRET and PalmGRET fragments were PCR amplified with Q5® High-Fidelity DNA polymerase (New England Biolabs) from pRetroX-Tight-MCS_PGK-GpNLuc (a gift from Antonio Amelio ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR products used for sequencing or plasmid synthesis were performed with Q5 high-fidelity polymerase (NEB). The resulting DNA fragment was digested and ligated into NdeI-xhoI digested pET21b(- ...
-
bioRxiv - Developmental Biology 2020Quote: ... The resulting PCR product was digested with StuI restriction enzyme (NEB, New England Biolabs, Ipswich, MA, USA), according to manufacturer protocols ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs, USA) which was finally performed in 7500 Fast Real-Time PCR System (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs, USA) which was finally performed in 7500 Fast Real-Time PCR System (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... one PCR product amplified from gBlock1 (JEP1862+JEP1863) and pMS26 digested with NotI using NEBuilder Hifi (NEB). pMTP114 was constructed by assembling two PCR products amplified from F plasmid (JEP1398+1340 and JEP1341+1399 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCRs were performed with KOD-Plus DNA polymerase (Toyobo, Osaka, Japan) or Q5 DNA polymerase (NEB, Beijing). The one-step cloning method was employed in plasmid construction according to the manufacturer’s instructions (Vazyme ...
-
bioRxiv - Immunology 2020Quote: ... and then Illumina barcoded and amplified with NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs). A portion of the reaction was performed as a separate qPCR reaction to determine ideal cycle number ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformants were screened by colony PCR using OneTaq 2x Master Mix (New England Biolabs, Ipswich, MA, USA). Production plasmids were isolated and analyzed by PCR and Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Developmental Biology 2020Quote: ... The resulting PCR product was digested with StuI restriction enzyme (NEB, New England Biolabs, Ipswich, MA, USA), according to manufacturer protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... The NOCT PCR insert and pcDNA5/FRT/TO were digested with BamHI and NotI restriction enzymes (NEB) before ligation with T4 DNA ligase (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was PCR amplified with Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Genetics 2020Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (#E7335, New England Biolabs), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Genetics 2020Quote: ... and the FRR1 gene was PCR-amplified with Phusion High-Fidelity DNA Polymerase (NEB, Ipswich MA, USA). PCR products were subjected to gel electrophoresis ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng A-tailed gel-isolated PCR product and 1 µl T4 DNA ligase (New England Biolabs) were mixed in a total reaction volume of 10 µl and incubated for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 minutes and processed on an AATI fragment analyzer.
-
bioRxiv - Developmental Biology 2020Quote: ... 3’UTRs were PCR amplified and cloned into the NheI site of pMTNCSU7 using Gibson cloning (NEB) to create pDMP45 (Pmex-5∷mNeonGreen∷nos-2 3’UTR) ...
-
bioRxiv - Microbiology 2019Quote: ... Regular PCR analysis was performed using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs) and detected by the T100™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Physiology 2019Quote: ... PCR products from the mutant allele of the F1 heterozygous were purified from gel bands (NEB #T1020S) and analyzed by Sanger sequencing ...
-
bioRxiv - Plant Biology 2019Quote: ... All cloning PCR reactions were performed with either Q5® High-Fidelity DNA Polymerase (New England Biolabs) or iProofTM High-Fidelity DNA Polymerase (BioRad Laboratories) ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Immunology 2019Quote: ... The pET28b plasmid and the PCR amplified target sequences were double digested using SalI-HF (NEB, # R3138S) and XbaI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The PCR fragments were recombined to the vector in 50 parallel NEBuilder HiFi DNA assembly reactions (NEB) according to the manufacturer’s instructions using 150 ng of linearized vector and 50 ng of custom CpG-free adapter-ligated genomic DNA ...
-
bioRxiv - Genetics 2020Quote: The SaCas9-KKH gene was amplified by PCR using Q5 polymerase (New England Biolabs, Ipswich, MA, USA) and inserted into the pET28a plasmid between the EcoRI and XhoI restriction sites using 2X HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The 2099bp region (EnVT15159) was PCR amplified from purified yw67 gDNA using Q5 DNA polymerase MasterMix (NEB) and the following primers:
-
bioRxiv - Pathology 2021Quote: ... These clones were further analyzed by genomic PCR using Long Amp Taq DNA polymerase (New England Biolabs) to check the downstream inserted sequence ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Immunology 2020Quote: ... PCR-product and linearized vector were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identify >99.5% was given ...
-
bioRxiv - Biochemistry 2021Quote: ... A PCR was then performed with VHH IgG specific primers and Deep Vent polymerase (New England Biolabs). Forward primers 6N_CALL001 5′-NNNNNNGTCCTGGCTGCTCTTCTACAAGG-3′ and 6N_CALL001B 5′-NNNNNNGTCCTGGCTGCTCTTTTACAAGG-3′ target the leader sequence ...
-
bioRxiv - Microbiology 2020Quote: ... which were PCR-amplified and ligated using exonuclease-based Gibson-assembly (Gibson Assembly Mastermix, New England Biolabs). Expression plasmids pcDNA4-mmPlxdc1-myc (macaca mulatta ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified with i5/i7 Nextera primer index mix and Q5 PCR Master Mix (NEB #M0492L): 5 min 72°C ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified by PCR using a Phusion High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA). The 4-nucleotide overhangs and the BsaI target sites at 5’ strands at both borders were added by including these sequences in the primers ...
-
bioRxiv - Physiology 2021Quote: PCR amplification of DNA from plasmids or fly genomic DNA was done using Phusion polymerase (NEB – M0530). Digestion of plasmids with restriction enzymes was done at 37 °C for 2-3 hours ...
-
bioRxiv - Molecular Biology 2021Quote: RNA used for RT-PCR was treated with 8 U of DNase I (RNase-free, NEB, M0303) for 15 min at 37 °C in a 50 μl reaction ...
-
bioRxiv - Developmental Biology 2021Quote: The robo2robo2 donor construct was assembled from four PCR fragments via Gibson assembly (New England Biolabs #E2611). The four fragments were derived from pBluescript (plasmid backbone) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were used as template for in vitro transcription via T7 polymerase (New England BioLabs (NEB)) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were used as template for in vitro transcription via T7 polymerase (New England BioLabs (NEB)) ...