Labshake search
Citations for New England Biolabs :
3651 - 3700 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The pool was amplified by PCR with primers oBZ131 (GCTAATACGACTCACTATAGGG) and oTC_pool2_rev (GTCCTTGGTGCCCGAGTG) using Phusion Polymerase (NEB). PCR reactions were supplemented with 3% DMSO and gel purified prior to in vitro transcription ...
-
bioRxiv - Immunology 2021Quote: The pcDNA3.1-hCD4-tGFP-P2A-mCherry construct was cloned by assembly of PCR fragments (New England BioLabs) from the pcDNA3.1 expression vector (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Genomics 2021Quote: ... 25 ul PCR reactions were prepared with LongAmp Taq 2x Master Mix (New England Biolabs, Inc; M0287L) and 0.4 uM of each primer ...
-
bioRxiv - Genomics 2021Quote: ... PCR reaction according to the manufacturer’s protocol (annealing temperature: 60°C; elongation time: 15sec, 19 cycles) (NEB). Of this reaction ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were enriched by PCR using Q5 High-Fidelity 2X Master Mix (New England Biolabs, #M0492S) and sequenced by the Illumina NextSeq 500 system in the Genomics Facility Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP tag was firstly PCR amplified from pSNAPf Vector (Cat. #N9183S, New England Biolabs, Ipswich, MA, USA) using primers 5’-CGT ACG ATC GAA TTC CCC ATG GAC AAA GAC TGC GAA ATG AAG CGC ACC ACC-3’ (forward ...
-
bioRxiv - Genetics 2020Quote: ... Each well contained 50 μL of NEBNext High Fidelity 2X PCR Master Mix (New England Biolabs, M0541), 0.5 μL of each primer at 100 μM ...
-
bioRxiv - Cell Biology 2020Quote: The Mage-b10 locus was amplified by PCR and then amplicons were digested with BslI enzyme (NEB) at 55°C for 1 hour in NEB Cutsmart buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... oligos were annealed and extended with Bottom strand ultramer_2 using Phusion High-Fidelity PCR Mastermix (NEB, M0531) with Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... and assembled into PCR-linearized (primers 454 and 455) pUC19-Kan by Gibson assembly (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... the wild-type and OGG1 (G245A) coding sequences were amplified by PCR with Phusion DNA polymerase (NEB) (primers indicated in Table S2 ...
-
bioRxiv - Genomics 2022Quote: ... and the PCR products were analyzed in 1% agarose with 1 kb DNA Ladder (New England Biolabs). Primers used in this study are shown in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... LRR-RLPs with no introns were PCR amplified from genomic DNA (Q5 Hot Start High-Fidelity, NEB), all others (Phvul.007g246600 and Vigun07g039700 ...
-
bioRxiv - Microbiology 2022Quote: ... Genes were PCR-amplified and inserted by ligation or NEBuilder HiFi DNA Assembly (New England Biolabs, E2621) or transferred from another plasmid by restriction digest and ligation ...
-
bioRxiv - Microbiology 2023Quote: ... coli plasmid DNA were amplified by PCR with Phusion High-Fidelity DNA Polymerase (New England Biolabs, NEB) using primers as indicated in Table S1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... colony PCRs were performed using the commercial OneTaq™ master mix (New England BioLabs; Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR primed with pJ327-pJ328 was performed using Phusion High Fidelity DNA Polymerase (NEB, Ipswich, MA) according to the manufacturer’s protocol on an Applied Biosystems 2720 Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... Real-time PCR was performed using SYBR green gene expression assays (New England Biolabs, catalog no. M3003S) on a QuantStudio 6 instrument (Applied Biosystems) ...
-
bioRxiv - Genomics 2022Quote: ... 25 μL of 2xKAPA NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs, Cat. M0543L), and 0.5μL of 100x SYBR Green I dye (FMC BioProducts ...
-
bioRxiv - Plant Biology 2022Quote: ... the MpCNL1 (Mp3g01950,1-266aa) and MpCNL1ΔN (Mp3g01950,31-266aa) were cloned by PCR (Q5 High Fidelity Polymerase, NEB) with attL-containing primers using codon optimized gene fragments as a template ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR amplification spanning the gene deletion was achieved using Phusion High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacturers protocol and visualized on 1% agarose gel supplied with ethidium bromide.
-
bioRxiv - Plant Biology 2024Quote: ... PCR reactions were run on 1.2% TAE agarose gel with a standard 1kb ladder (New England BioLabs) to confirm formation of products ...
-
bioRxiv - Plant Biology 2024Quote: ... the respective promoter was isolated via PCR using Phusion High Fidelity Enzyme (New England Biolabs, no. M0530L) and inserted upstream of GUS gene of pCambia1301 vectors ...
-
bioRxiv - Plant Biology 2024Quote: ... and the genes were PCR-amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... The DNA fragment carrying the cassette was obtained by overlap PCR using Q5 polymerase (New England Biolabs). For each target gene ...
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions followed the manufacturer recommended recipe for Phusion High Fidelity Polymerase (New England BioLabs, Inc.) with these PCR conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Size-selected cDNA was then PCR amplified for 12 cycles using Q5 High-fidelity polymerase (NEB #M0491S). Amplified libraries were then run on a 6% TBE gel ...
-
bioRxiv - Biochemistry 2024Quote: Point mutants were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs) or Herculase II (Agilent) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 μL of PCR product from the inner primer amplification was cleaned using 5μL Exonuclease I (NEB) and 2μL rSAP (NEB) ...
-
bioRxiv - Microbiology 2024Quote: LT area was amplified from 12-week gDNA with PCR using Q5 High-Fidelity DNA Polymerase (NEB) and cloned to pUC19 vector to BamHI/HindIII site ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting GlnA1_opt PCR-product and vector pRS375 were restricted with NdeI and BamHI (NEB, Schwalbach, Germany); the resulting pRS375 vector fragment and the GlnA1 fragment were ligated resulting in pRS1841 ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR reactions were purified using GeneAid and ∼100 ng of DNA subjected to digestion by NaeI (NEB). Clones that showed no apparent digestion product (due to the modification of the NaeI restriction site ...
-
bioRxiv - Evolutionary Biology 2024Quote: Genomic DNA and cDNA PCRs were carried out using OneTaq polymerase (New England Biolabs, Ipswich, MA, USA) as per instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 PCR cycles for enrichment of adaptor-ligated DNA with unique dual index primer pairs from NEB. The libraries were sequenced on the NovaSeq 6000 system with NovogeneAIT Genomics ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... The 3’ ends of the VSV G and GP64 ORFs were PCR-amplified (using Taq polymerase, NEB) from DNA isolated from each fly line ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... France) the amplicon obtained from PCR using Q5 high-fidelity DNA polymerase (#M0491; New England Biolabs NEB) and the primers Salten-pb1-3183-F / Salten-pb1-4136-R primers (TableS1) ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... PCR mix and thermocycler conditions were set according to the Phusion Master Mix protocol provided by NEB. PCR products were measured and visualized using a D5000 ScreenTape System (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... Transcript expression was analyzed via reverse transcriptase quantitative real-time PCR using Lunaprobe reagent (New England Biolabs) on a Quantstudio3 thermocycler (ABI) ...
-
bioRxiv - Microbiology 2024Quote: All PCRs needed for cloning were carried out with high fidelity enzymes Q5 polymerase (New England Biolabs) or Accuzyme (Bioline) ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reaction (PCR) amplification steps were performed using Phusion DNA polymerase (NEB, Whitby, Ontario, Canada). Primers used for PCR amplification were ordered from Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCC 7002 gDNA by PCR using the Syn0852-FULL-F6/R4 primers and Phusion DNA polymerase (NEB). The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR reactions were performed with Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions and products were run on a 1% agarose gel alongside an appropriately sized ladder (either New England Biolabs 100 bp or 1kb DNA ladder ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.5 % Tween-20 and the selected genes amplified by PCR using Q5® Hot Start polymerase (NEB) using forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments of the nucleosome library present in each section were amplified via PCR (NEB Taq Polymerase) by using as primers the sequences of the Asc1 and BamH1 adapters described in Supplementary Fig ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions were carried out using Q5 High Fidelity Hot Start DNA Polymerase (New England Biolabs (NEB), UK) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR reactions were carried out using Q5 High Fidelity Hot Start DNA Polymerase (New England Biolabs (NEB), UK) ...
-
bioRxiv - Microbiology 2023Quote: ... Each fragment was amplified by PCR using the Q5® High-Fidelity DNA Polymerase (NEB, Cat #: M4091L) following the manufacturers protocols ...
-
bioRxiv - Genetics 2023Quote: ... gRNA templates were PCR amplified and gRNAs were in vitro transcribed with T7 transcriptase (NEB, cat# M0251S). gRNAs and Cas9 protein (NEB ...