Labshake search
Citations for New England Biolabs :
3901 - 3950 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplified fragments to be used for recombineering were produced with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions for molecular cloning was carried out using Q5® High-Fidelity DNA Polymerase (NEB, M0491) while colony PCR was carried out using Taq Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... end-point PCR assays were carried out with Hot Start Taq 2X Master Mix (New England Biolabs, USA) in a 20 μL reaction mixture containing 0.5 units of taq polymerase ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were combined together by PCR using the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA). The resulting fragment was 2.2 kbp was gel-purified ...
-
bioRxiv - Genomics 2019Quote: ... 2 min at 50ºC and 15 min at 72ºC) using Phusion High-Fidelity PCR Master Mix (New England Biolabs). A biotinylated oligo (Bio NotI-P 5 -P ET ...
-
bioRxiv - Biophysics 2019Quote: ... The purified PCR product was assembled into the vector using Gibson Assembly (NEB Gibson Assembly 2x Master Mix), and transformed into E ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR product was indexed with Illumina sequencing primer-set by utilizing the Phusion HF Taq Polymerase (NEB), followed with gel purification ...
-
bioRxiv - Genetics 2019Quote: ... The sgRNA-coding region was amplified by PCR using Q5® Hot Start High-Fidelity DNA Polymerase (NEB) in a reaction volume of 50 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... To discriminate wildtype from heterozygous larvae PCR products were digested with the restriction enzyme NlaIII (New England Biolabs) which digests wildtype but not mutant sequence (WT 155 bp ...
-
bioRxiv - Cancer Biology 2019Quote: ... UltraScript 2.0 (PB30.31-10, lot #PB130614-01-5, PCR Biosystems, Wayne PA) and WarmStart RTx (M0380L, lot #0061705, NEB) by each manufacturer’s protocol with minor modifications ...
-
bioRxiv - Microbiology 2019Quote: ... primase P4 and a hypothetical gene of joined anacy_RS29550 and anacy_RS29775 were PCR amplified by Phusion High-Fidelity DNA Polymerase (NEB) with specific primers listed in Table S1 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR enrichment of adaptor-ligated cDNA libraries was used to incorporate indices from NEBNext Multiplex (NEB #E7335, #E7500) Oligos for Illumina ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR products were treated with 10 units (0.5 μL) of DpnI restriction endonuclease (New England Biolabs Ltd., #R0176), incubated at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... existing vectors were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) with primers designed to delete the RSINE1 element by site directed mutagenesis ...
-
bioRxiv - Molecular Biology 2019Quote: ... The extra sequence was generated by PCR amplification from hESC genomic DNA and added by Gibson assembly (NEB). The long isoform of BRD3 with N-terminal mEGFP (FLAG-mEGF-BRD3 ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR-amplified sequences were ligated into a NotI- and BssHII-digested BlucB plasmid using DNA ligase (NEB) and transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: SP graftings were performed using overhanging primers to the various V-genes via PCR using Q5 polymerase (NEB) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon-containing fragments were enriched by PCR using ComP7 primers ComP5 using Phusion DNA polymerase (New England Biolabs) in a 20-cycle reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... the entry vector and the PCR fragments were assembled using the Gibson Assembly Master Mix (New England BioLabs), following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... were reinjected at 75 μl/h and co-flowed with 150 μl/h PCR mix (1.65x NEBNext Ultra II Q5 Master Mix, 0.033 U/μl USER II (NEB), 1.32 M Propylene glycol ...
-
bioRxiv - Genomics 2019Quote: ... we amplified 20 ng of the library with HSS-pGL4_F and HSS-pGL4_R1 (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB) for 16 cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The PCR reactions were carried out using Phusion High-Fidelity DNA Polymerase and GC buffer (New England Biolabs) in a ProFlex PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 135 ng purified PCR product from the previous reaction and 25 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Microbiology 2020Quote: ... 8 cycles of PCR amplification were performed using NEBNext® Q5 Polymerase 2X Master Mix (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were constructed by ligating PCR products amplified with Q5® High-Fidelity DNA polymerase (New England Biolabs) using Golden Gate DNA assembly43 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... which were then transformed into E.coli and verified by colony PCR using OneTaq Quick-Load Polymerase (M0486L, NEB) and restriction digestion by NotI (FD0596 ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification primers were design with the complementary overhangs necessary for Gibson assembly using NEBuilder (New England Biolabs). The sequence for the forward primer was ...
-
bioRxiv - Synthetic Biology 2021Quote: All PCR amplifications for plasmid construction and cloning were performed using Q5® High-Fidelity DNA Polymerase (NEB), followed by purification with Monarch® PCR & DNA Cleanup Kit (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 3xHA-miniTurbo-NLS_pCDNA3 was linearized by PCR and THRB cDNA was inserted via HiFi Assembly Cloning (NEB E5520S) to create the 3X-HA-miniTurbo-TRβ vector ...
-
bioRxiv - Immunology 2021Quote: ... For all PCR reactions the Q5 Hot Start High fidelity DNA polymerase was used (New England Biolabs Inc.), according to the manufacturer’s instructions and adapting the elongation time to the size of the amplicon ...
-
bioRxiv - Molecular Biology 2020Quote: ... The purified PCR products were then assembled into intact plasmid using Gibson Assembly Master Mix (NEB, Cat.No. E2611). The newly assembled plasmid was transformed into E.coli Trans5α chemically competent cells (Transgene ...
-
bioRxiv - Genomics 2020Quote: ... and a second ExoI step was used before the PCR products were purified with columns (Qiagen or NEB) or Kapa beads (Roche Diagnostics) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The repair templates were ordered as gene blocks (IDT) and PCR amplified with Phusion polymerase (NEB cat.#M0503S). The RPS25 KO1 cells were seeded into the well of a 6-well plate at 250,000 cells/well and 24 hrs post-seeding the PX458 plasmids and respective homology templates were co-transfected into the RPS25 KO cells using Lipofectamine 3000 (ThermoFisher cat.#L3000075) ...
-
bioRxiv - Genomics 2021Quote: ... 50 µl of ULR-Phusion mix (1.2 µl ULR Ladder, 28.8 µl H2O, 30 µl Phusion PCR mastermix [New England Biolabs] and the samples were mixed with 147.5 µl ProNex chemistry ...
-
bioRxiv - Genetics 2021Quote: ... PCR products destined for cloning were made with Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Genetics 2021Quote: ... Fragments from TIRA and TIRB were PCR-amplified using EpiMark Hot Start Taq DNA Polymerase (New England BioLabs). For TIRA ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification was performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs) and primers KhE5-4 (GACGGTGACACTGTTCATGC ...
-
bioRxiv - Cell Biology 2020Quote: ... a semi-quantitative RT-PCR reaction was performed using Q5 Hot Start High-Fidelity DNA polymerase (NEB, M0493S) in a LabCycler thermocycler (SensoQuest) ...
-
bioRxiv - Genomics 2021Quote: Primers were used to amplify individual subpools using 25 µL 2x NEBnext PCR master mix (New England Biolabs), 2 µL of oligonucleotide pool (-40 ng) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was conducted in 50-μl volumes using Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA). Primers for rpmH (F ...
-
bioRxiv - Microbiology 2020Quote: ... The two PCR fragments were each gel-purified and assembled together using a 2x Gibson master mix (NEB). Gibson assembly was possible due to a 23 bp sequence shared between the two PCR fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... σA-FLAG and RbpA-FLAG proteins were prepared by PCR using Q5® High-Fidelity DNA Polymerase (NEB) with primers #3130 + #3131 (HelD) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10uM Illumina compatible forward and reverse PCR primers were added together with Q5 master mix (NE Biolabs, M0544S) followed by Ampure XP purification with 1:1 ratio ...
-
bioRxiv - Molecular Biology 2021Quote: Single and double residue substitutions were introduced in Opto-β2AR-2.0 using overlapping oligonucleotides (designed in PrimerX (https://www.bioinformatics.org/primerx/) using the QuikChange option) and circular PCRs with a high-fidelity polymerase (Q5, NEB) followed by digestion with DpnI restriction enzyme (NEB).
-
bioRxiv - Plant Biology 2020Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The purified PCR product was digested with XhoI and NheI restriction enzymes for 3h in CutSmart buffer (NEB). One hour before the end of the reaction ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were carried out with Phusion Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). After digestion with BamH1 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR reactions were carried using Phusion DNA polymerase or Taq DNA Polymerase using commercial buffers (New England Biolabs). Reactions were run on a BioRad C1000 Touch thermal cycler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The last two regions were PCR-amplified from genomic DNA with EcoRI and NotI (New England Biolabs, R3189S) added to the primers (5’-ATGACAAGGGCAGCGAATTCATGGCCAGTGCACAAGTG-3’and 5’-GTACCCTCGAGCCGCGGCCGCGCTTGAGTAGGCAATTACGAC-3’) ...