Labshake search
Citations for New England Biolabs :
3851 - 3900 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR amplification was performed using the QUILLS primer set and Q5® High-Fidelity DNA Polymerase (NEB #M0491) as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gel-purified PCR product was then cloned into the pGL4.23 vector using T4 DNA ligase (New England Biolabs). Finally ...
-
bioRxiv - Biophysics 2021Quote: ... Other constructs were cloned by PCR and DNA assembly (NEBuilder HiFi DNA Assembly Master Mix; New England Biolabs). The RGG domain used here is the N-terminal IDR (residues 1-168 ...
-
bioRxiv - Cell Biology 2021Quote: ... and the polymerase chain reaction (PCR) was used to amplify DNA fragments with Phusion polymerase (New England Biolabs) of the genomic sequence using a forward primer that starts from 2199 bases upstream of the ATG start codon of zipt-2.3 and a reverse primer that contained the codon preceding the stop codon of zipt-2.3 and the coding sequence of the T7 epitope (MASMTGGQQMG) ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR was carried out under standard conditions using the Q5® High-Fidelity DNA Polymerase (New England Biolabs). Samples were kept at 98 °C for 30 s (1 cycle) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR reactions for amplicon generation were carried out with Q5 High-Fidelity DNA Polymerase (NEB, cat. no. M0491). pCineo_EGFP_Giant_CT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Invitrogen Platinum™ SuperFi™ Green PCR Master Mix or Q5® High Fidelity Polymerase (New England Biolabs) were used for generation of backbones from p005 and p006 vectors (appendices ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The template was eliminated after the PCR reactions by addition of 1 µL DpnI (10,000 U/mL, NEB) to 25 µL PCR reactions and incubation at 37 °C for at least 1 h ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Full plasmid sequences and descriptions of the individual cloning steps can be provided upon request ...
-
bioRxiv - Microbiology 2020Quote: All PCR was performed using 0.02 U/μl Q5® High-Fidelity DNA Polymerase (New England Biolabs, US), 1x Q5® Reaction Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 100ng of each gDNA sample was PCR amplified in triplicate with Q5 High-Fidelity DNA Polymerase (NEB #M0494S) with 500nM primers (Supplemental table 4 ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was conducted in a total volume of 25 μl that contained 1X Q5 buffer (New England Biolabs), 0.25 μM of each primer ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR enrichment of adaptor ligated DNA was conducted using NEBNext Multiplex Oligos for Illumina (Set 1, NEB#E7335). The PCR reaction was purified using Agencourt AMPure XP Beads ...
-
bioRxiv - Synthetic Biology 2021Quote: ... elegans codon adaptor.[48] PCRs were carried out using Q5 2x Hot-Start Master Mix (New England Biolabs). PCR and digestion products were recovered from agarose gels following electrophoresis using the Zymogen Gel Recovery Kit (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR product and pRRK plasmid were digested with the XBaI restriction endonuclease (New England Biolabs, Ipswich, MA). The digested plasmid was then incubated twice with Antarctic Phosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... Cloned genes (below) were used as template DNA for PCRs with Phusion polymerase (New England Biolabs, Ipswich, MA). Complete dsRNA synthesis protocols ...
-
bioRxiv - Biophysics 2020Quote: ... The three PCR generated fragments were assembled in the presence of pUC18 digested with NdeI and PstI (NEB) by Gibson Assembly according to the manufacturer specifications to create pUCΔF1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Alternative sgRNA sequences (Supplementary Table S2) were generated by PCR reactions with Q5-High-Fidelity DNA-polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... ATGTGGGCCCGGCACCTTAA were used to amplify the pool using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (∼40 ng) ...
-
bioRxiv - Genetics 2022Quote: ... The DNA was used as a template for PCR using Q5 Hot Start DNA Polymerase (New England Biolabs), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: DNA fragments were generated by conventional PCR (primer sites underlined) supplementing the reaction with either methylated (NEB, N0356S) or un-methylated cytosine (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Each PCR product was then run on an agarose gel and purified using a gel extraction protocol (NEB). The purified PCR product concentrations were measured using the Picogreen assay (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2022Quote: The gRNA entry vectors were constructed by PCR amplification with Q5 High-Fidelity DNA polymerase (New England Biolabs) of the entire pGG-[B-F]-OsU3-BbsI-ccdB-BbsI-[C-G] plasmids according to the manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using 100 ng of genomic DNA and Q5 High-Fidelity Taq Polymerase (New England Biolabs) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ~500 bp sequences flanking the fadX gene (SAUSA300_0229) were amplified by PCR using Q5 DNA Polymerase (NEB M0491L). For cloning purposes ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was used as template in PCR reactions containing the Taq 2X Master Mix (New England Biolabs) and 5 μM of MP2- and scorpine-specific primers (Table S7) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing libraries were amplified and barcoded with NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0541S) and size selected with AMPure XP beads (Beckman ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification was carried out by using Phusion® High-Fidelity DNA polymerase from New England Biolabs (NEB) on a T100TM Thermal cycler from Bio-Rad and the primer pairs listed in Supplementary Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... the regions of interest were amplified and barcoded using nested PCR with Phusion High-Fidelity DNA Polymerase (NEB), an internal primer containing TSA7 and a footprint sequence ~100-150 nt from the predicted end (oHR542/543/544/545 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 µL of PCR product from the inner primer amplification was cleaned used 0.5 µL Exonuclease I (NEB) and 1 µL rSAP (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Consistently incomplete assemblies or local ambiguities were solved by PCR amplification using the high-fidelity polymerase Phusion (NEB) followed by Sanger Sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR-amplified insert and the vector backbone were each cut with appropriate restriction enzymes (New England Biolabs). After dephosphorylation of the backbone (using FastAP dephosphorylase ...
-
bioRxiv - Developmental Biology 2021Quote: ATAC-seq library was amplified from 20μl tagmented DNA with 25μl 2x Phusion PCR master mix (NEB, 28006) and 0.625μl of each 100mM library primers ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR products were separated on agarose gels and purified for Sanger Sequencing (Microsynth) using ExoSAP-IT reagent (NEB). Chimeric PCR products were subcloned before sequencing using StrataClone PCR cloning kits (Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification was performed using the high-fidelity enzyme Q5 from New England Biolab (NEB, Cat number M0530L) or the Platinum SuperFi DNA polymerase from ThermoFisher (Cat number 123551010 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR product and the new AT1.03 and AT1.03R122KR126K in pDRF1-GW were digested with EcoRI (New England Biolabs) and NotI ...
-
bioRxiv - Immunology 2020Quote: ... The digested PCR fragment and pGEM-4Z vector were then ligated using T4 DNA ligase (New England Biolabs) per manufacturer instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR products were purified and then digested using NotI and ApaI restriction enzymes (NEB, Ipswich, MA, USA). The modified OR sequences were separated by gel electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Neuroscience 2020Quote: ... The purified PCR product and the linearized backbone were assembled using Gibson assembly (New England Biolabs, Ipswich, MA). DNA was transformed into Stable competent cells (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... The popZ insert and the plasmid PCR product were assembled together using the Hifi DNA assembly mix (NEB). The construction was verified by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... For all PCR reactions the Q5 Hot Start High fidelity DNA polymerase was used (New England Biolabs Inc.), according to the manufacturer’s instructions and adapting the elongation time to the size of the amplicon ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification was performed using the Q5® Hot Start High-Fidelity DNA Polymerase (New England BioLabs Inc.) and the corresponding protocol28 with an annealing temperature of 66°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting cDNA was then further amplified through nested PCR using Phusion 2X Hot Start Flex MasterMix (NEB), as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were prepared as described above used as DNA template for PCR amplification using Phusion polymerase (NEB) and oligonucleotides that anneal 150 bp outside of wzc ...