Labshake search
Citations for New England Biolabs :
3951 - 4000 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... a 30 cycle PCR amplification was performed using the Biotin_Short_pHIMAR and NC102 primers (Table S3) using Q5 mastermix (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 30 cycles (15 seconds 98°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... A gja11-specific template was then generated by PCR using Phusion polymerase (Cat. No. M0530L; New England BioLabs) and the following primer pair ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplified PCR product was cleaned prior to cycle sequencing by exonuclease I/shrimp alkaline phosphatase (New England Biolabs) and used for bi-directional Sanger sequencing on an ABI 3730 automated sequencer (MCLAB) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2) using Q5 polymerase (NEB) and genomic DNA templates obtained from the Liebniz Institute [dsmz.de] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were prepared for sequencing using Exonuclease I and Antarctic Phosphatase (New England Biolabs, Ipswich, MA, USA). Sequencing reactions were carried out in 10µl volumes with 80ng of prepared template ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions were performed with Phusion High Fidelity DNA Polymerase following the manufacturer’s instructions (NEB – New England Biolabs). All primers used in this study are available in Supplementary Table S1.
-
bioRxiv - Immunology 2020Quote: ... The nested PCR assays were run using the NEB enzyme Q5® Hot Start High-Fidelity (NEB, M0491) as follows ...
-
bioRxiv - Microbiology 2020Quote: First-round PCR product was subjected to an enzymatic cleanup by adding 1μL Antarctic phosphatase (New England Biolabs), 1μL Exonuclease I (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Immunology 2021Quote: ... The other pcDNA3.1-tGFP-P2A-mCherry reporter constructs were cloned by assembly of PCR fragments (New England BioLabs) from different sources ...
-
bioRxiv - Microbiology 2021Quote: ... while all other fragments were amplified by PCR using the Q5 HotStart High-Fidelity 2X master mix (NEB). All plasmids were sequence-verified with Sanger sequencing (Macrogen Europe ...
-
bioRxiv - Immunology 2020Quote: The second PCR product (V, D, J heavy genes) was cloned in frame by HiFi assembly (NEB, UK) into the KpnI/PstI (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... 16 ng/uL single-stranded pooled oligos were amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB) with the following PCR protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Regions of interest were amplified by PCR using a One-Taq Hot Start DNA-polymerase (New England Biolabs) with standard buffer and 3% DMSO and the following primers targeting exon2 (L ...
-
bioRxiv - Genomics 2020Quote: ... the beads resuspended in 20μL EB buffer were used for PCR amplification using 25μl Phusion High-fidelity MasterMix (2X) (New England BioLabs), 4 μl nuclease-free water and 0.5 μl PCRgraftP5 primer (5uM ...
-
bioRxiv - Genetics 2020Quote: ... Primers were used to amplify individual subpools using 25 μL 2x NEBnext PCR master mix (New England Biolabs), 2 μL of oligonucleotide pool (~40 ng) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... upstream and downstream regions of about 750 bp flanking the each gene were amplified by PCR (Q5 NEB) from the B ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were cloned into a pBR-PLac vector digested with AatII and EcoRI (New England Biolabs)(54 ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently amplified with Nextera sequencing primers and NEB high fidelity 2X PCR master mix (New England Biolabs) for 11 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: Linear double-stranded DNA templates were prepared by 500uL PCR reactions using 50uL 10X Thermo Pol buffer (NEB), 10uL dNTP (10mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... and barcoded libraries were generated using the NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) and Nextera index primers (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... All PCRs were performed with the Q5 Hot Start HF DNA Polymerase (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S). Edited lines showed a 2.4kB band corresponding to the deletion allele in contrast to the 3.6kB unedited ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were PCR amplified from the entire isolated genomic DNA using NEBNext Ultra II Q5 Master Mix (NEB) and the primers v2.1-F1 and v2.1-R1 ...
-
bioRxiv - Immunology 2022Quote: ... PCR reaction was set up according to NGS protocol of NEBNext UltraTM II Q5 Master Mix (NEB, Cat.M0544S). PCR products were purified by AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a 12-cycle polymerase chain reaction (PCR) using high-fidelity Phusion DNA Polymerase (New England BioLabs). DNA amplification was confirmed using Qubit fluorometry ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of PCR products were mixed with 5.5 uL ddH2O and 1.9 uL 6X gel loading dye (NEB) and loaded onto 1% w/v agarose gels cast with SYBR Safe DNA gel stain ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR fragment and the vector were gel extracted and combined in a Gibson Assembly Reaction (NEB, E2611S) and transformed into DH5α ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Microbiology 2022Quote: ... Synthesized cDNA was used as template in PCR with the Q5 high-fidelity DNA polymerase (New England BioLabs) using intergenic region primers (Table S3 & S4) ...
-
The Arabidopsis MCTP member QUIRKY regulates the formation of the STRUBBELIG receptor kinase complexbioRxiv - Plant Biology 2022Quote: ... PCR fragments used for cloning were obtained using Q5 high-fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany). All PCR-based constructs were sequenced ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed on genes within pDNR207 constructs with Q5 High-Fidelity polymerase (New England Biolabs, Ipswich MA), and all constructs were sequence verified by GeneWiz prior to cloning into binary vectors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR amplifications were performed using Q5 High-Fidelity DNA polymerase Master Mix 2x from New England Biolabs (NEB). Due to the high GC content of C ...
-
bioRxiv - Molecular Biology 2022Quote: The PCR reactions were prepared as follows: Mix 1 μl of Phusion DNA Polymerase (New England Biolabs, M0530), 10 μl of 5x Phusion HF Buffer ...
-
bioRxiv - Cell Biology 2022Quote: The ARPC4 genetic sequence was isolated from Chlamydomonas cDNA using PCR with the Q5 DNA Polymerase (NEB, M0491L). The resulting fragment and the pChlamy4 plasmid (Thermofisher ...
-
bioRxiv - Plant Biology 2022Quote: Venus expression constructs were designed in SnapGene (v4.3.11) and generated by integrating PCR-amplified (Q5 hot start high-fidelity, #M0515, New England Biolabs) DNA fragments into plasmid pODC53 (Caspari ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic sequence of isolated clones at the target locus was further confirmed by PCR cloning (E#1202S, NEB) and Sanger sequencing (Australian Genome Research Facility ...
-
Microsatellite break-induced replication generates highly mutagenized extrachromosomal circular DNAsbioRxiv - Molecular Biology 2024Quote: ... Inverse PCR (iPCR) was performed on undigested total genomic DNA using Q5 HotStart polymerase (New England Biolabs, M0494S). The primers used for amplification are shown in Supplementary Table 2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR reactions were performed utilizing the Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs). Plasmids were sanger-sequenced to confirm the presence of all inserts ...
-
bioRxiv - Developmental Biology 2024Quote: ... the rbm8a wild type allele was genotyped by restriction digest of the PCR product with Xmn1 (R0194S, NEB) and the rbm8aΔ3 allele by Hinf1 (R0155S ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligation of the PCR product with the purified destination vector was performed using T4 DNA Ligase (M0202S - NEB) and transformed in Stbl3 bacteria ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting PCR products then underwent end-repair and A-tail addition followed by New England Biolabs (NEB) adapter ligation ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... All PCR amplifications for plasmid and vector constructions were performed using Q5 polymerase (New England Biolabs, Ipswich, MA). Most PCR reactions were performed using the following conditions ...
-
bioRxiv - Immunology 2024Quote: The second PCR step added NEBNext unique dual index primers onto the ends of the amplicon (NEB, #E6440S). This was achieved by a two-step PCR reaction containing the same reagents as in the first PCR step except the primers were 5 µl of the supplied unique dual index primer mix ...