Labshake search
Citations for New England Biolabs :
3451 - 3500 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR enrichment step was performed with NEBNext Multiplex Oligos for Illumina (Dual Index Primers, NEB #E7600), using 64 different combinations of indexed primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... The eluted transposed DNA was submitted to PCR using Q5 High-Fidelity Polymerase (New England Biolabs). DNA was amplified with 7 cycles of PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genetics 2023Quote: ... All PCR amplifications were done using Q5® High-Fidelity DNA Polymerase (New England Biolabs, UK) following manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and library amplification was performed using NEBNext® High-Fidelity 2X PCR Master Mix (M0541L-NEB) with Nextera Ad1_noMX and Ad2.X primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... pDEST17 was linearized by high fidelity PCR (Q5 High-Fidelity 2x Master Mix, NEB, Cat #M0492), during which sequence encoding the 6x His tag was removed ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... the PCR product was used for restriction digest with AvaI (New England BioLabs, Cat. No. R0152L) to identify the presence of the mutation ...
-
bioRxiv - Synthetic Biology 2023Quote: All PCR reactions used for plasmid assembly were done using the 2x Phusion mix from NEB, in a 50 µL volume ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 μl of PCR product was incubated with 0.5 μl of T7e1 enzyme (New England Biolabs) for 30 minutes at 37◦C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library was PCR amplified for 5 cycles using the NEBNext High-Fidelity MasterMix (New England BioLabs) followed by qPCR amplification to determine the exact number of additional cycles required for optimal library amplification ...
-
bioRxiv - Biochemistry 2023Quote: DNA templates for the transformation assays were prepared by PCR amplification from the pUC19 plasmid (NEB), after which the PCR fragments were Dpn1-treated ...
-
bioRxiv - Biochemistry 2023Quote: All plasmids were generated by using some combination of PCR amplification using Q5 DNA polymerase (NEB), HiFi Assembly (NEB ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 μL 25μM P5 adapter and 25 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). Transposed DNA was amplified for 5 min at 72°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genomics 2022Quote: ... oligo pools were PCR amplified in multiple reactions with low cycle number (NEB Ultra II MM), digested ...
-
bioRxiv - Biochemistry 2023Quote: ... the following was mixed: 20 μL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 2 μL 10 μM i5 indexing adapter ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library PCR amplification was performed with 10uL of 2x Phusion HiFi master mix (New England Biolabs), 8uL of cDNA sample ...
-
bioRxiv - Biochemistry 2023Quote: The PCR product was purified and 1 µg was phosphorylated using 10 units T4 PNK (NEB) in 20 µl of T4 ligase buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmid pJC1-trpE (7749 bp) was amplified by PCR using oligonucleotides with degenerated (NNK) codons (NEB Q5 Site-Directed-Mutagenesis Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed on genomic DNA by using Q5 High-Fidelity Taq Polymerase (New England Biolabs) followed by T7 endonuclease I assay (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR products were used as templates for transcription reactions using T3 RNA polymerase (Biolabs, M0378S) or T7 RNA polymerase (TOYOBO ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µL PCR Anchor Primer,1 µL Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, Inc., N0447L), 10 µL Q5® Reaction Buffer (New England BioLabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were then isolated via gel electrophoresis and assembled using HiFi assembly mix (NEB #E2621L). Plasmids were verified by DNA sequencing and stored at -20°C until use in NanoBRET assays.
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Cancer Biology 2023Quote: ... TCRs were then amplified by PCR (20 cycles with the Phusion from New England Biolabs, NEB) with a single primer pair binding to the constant region and the adapter linked to the TRAV/TRBV primers added during the reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: ... The effector AVR-Pii from was obtained via PCR amplification using Phusion Polymerase (New England Biolabs). Primers were designed on the promoter and terminator of ZiF_VIIIc from BTJP 4-1 and included the overhangs required for plasmid assembly ...
-
bioRxiv - Immunology 2023Quote: ... All cloning PCR amplifications were performed using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to standard procedures ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified for 12 cycles using NEBNext® High-Fidelity 2X PCR Master Mix (NEB) in total volume of 25µl in the presence of 800nM of barcoded primers (400nM each ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was digested with enzymes NcoI and HindIII (New England Biolabs, Ipswich, Massachusetts, USA), ligated back into the pOPINB vector with T4 DNA ligase (New England Biolabs) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Genes were amplified by PCR from a testis cDNA library and digested by EcoR I (NEB) and Nde I (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... Homology arms were amplified from HaCat cell genomic DNA via PCR using Q5 DNA polymerase (NEB). The −loxP-PGK-Em7-NeoR-loxP- cassettes were amplified from PL452 (79) ...
-
bioRxiv - Immunology 2023Quote: ... for mouse was PCR-amplified and ligated into this vector via Gibson assembly (NEB, Cat# E2621S). The ligated product was precipitated ...
-
bioRxiv - Microbiology 2023Quote: ... and 12.5 μL of master mix (2X Phusion High-Fidelity PCR Master Mix, New England Biolabs). The high ratio of exterior to interior primers helps ensure the dominant product is the desired full-length amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were gel-purified and assembled using NEBuilder® HiFi DNA Assembly Master Mix (NEB). The assembled product was transformed into NEB 5-alpha Competent E ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich MA, USA). For ITS we used the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... The gRNA cassette was amplified using the NEBNext® High-Fidelity 2X PCR Master Mix (NEB) and primers including Illumina adaptors and 8nt barcodes to allow Next Generation Sequencing analysis (Supplementary Table 2) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2µg of resulting PCR products were then digested with Pst1-HF restriction enzyme (New England Biolabs) to cleave the unspliced XBP1 template ...
-
bioRxiv - Cell Biology 2023Quote: ... Mutagenesis on Cas9 and cGAS was performed by conventional PCR followed by HiFi DNA Assembly (NEB) or In-Fusion cloning (Takara Bio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... downstream of a T7 promoter using overlap-extension PCR with Q5 High-Fidelity DNA Polymerase (NEB) and InFusion cloning (Takara Bio) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All colony PCRs were done using Quick-Load® Taq 2X Master Mix (New England Biolabs) according to the manufacturer’s recommendation ...
-
bioRxiv - Genetics 2024Quote: ... and all PCR products were generated with Phusion® High-Fidelity DNA Polymerase (New England BioLabs) and purified using NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2024Quote: ... phi47 orf65 (tifA) and orf65-L32F were PCR amplified using Q5 master mix (New England Biolabs) and cloned into pLZ12A ...
-
bioRxiv - Cell Biology 2024Quote: ... Doxycycline inducible CCDC134 constructs were cloned by PCR amplification followed by Gibson assembly (New England Biolabs) into pLenti-TRE- rtta3G-BLAST.
-
bioRxiv - Genomics 2024Quote: ... and amplified with 14 cycles of PCR using LongAmp Taq Master Mix (New England Biolabs, UK). cDNA was quantified using the Qubit DNA High sensitivity assay (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed according to manufacturer directions using Q5 or OneTaq DNA Polymerases (NEB, Ipswitch, MA). DNA was digested with restriction enzymes from New England Biolabs (NEB) ...