Labshake search
Citations for New England Biolabs :
3751 - 3800 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 2 uL dNTP Solution Mix (10 mM stock, NEB), 2 μl Taq DNA ligase (80 U ...
-
bioRxiv - Cancer Biology 2023Quote: ... digested annealed DNA with 10 U of T7eI (NEB) at 37 °C for 45 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl 10 U/μl PmeI (NEB R0560S) in 400 μl 1x CutSmart buffer ...
-
bioRxiv - Biophysics 2023Quote: ... and 10 U T4 polynucleotide kinase (New England Biolabs) in a final volume of 10 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 µl of 20 mg/ml RNase A (NEB) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% SDS and 10 U/ml Proteinase K (NEB), followed by an 18-hour incubation at 56 °C with vigorous shaking ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.4 μL 10 mM dNTP solution (New England Biolabs), 4 μL 5× phusion HF buffer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein A beads (10 µl, New England Biolabs, #S1425) were washed twice in coIP-solution and consecutively incubated for 1 hour at 4°C with an anti-synaptopodin antibody (rabbit anti-Synaptopodin ...
-
bioRxiv - Genetics 2024Quote: ... 10 µL Proteinase K (NEB #P8107, 20 mg/ml), and 10 µL 1M DTT (GoldBio #DTT in dH2O ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transformed into NEB 10-beta electrocompetent cells (NEB C3020K), and extracted using the Qiagen Plasmid Maxi Kit (Qiagen 12162) ...
-
bioRxiv - Cell Biology 2024Quote: ... Assemblies were transformed into 10-beta competent cells (NEB) and plated onto LB agar plates for overnight incubation at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL 10× T4 RNA Ligase Reaction Buffer (NEB), 6 µL PEG8000 (50%) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 mM Ribonucleoside Vanadyl Complex (NEB # S1402S - 200 mM), formamide (Midsci ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This point mutation was corrected back to wild type by site-directed mutagenesis using Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a donor DNA containing two homology arms flanking the DsRed sequence for homology repair were cloned into the pHD-ScarlessDsRed plasmid using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Left homology arm contained the sequence in 3R:16188287-16189463 ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 ng of plasmid DNA was used per PCR reaction and used in a volume of 50 µl using Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol) ...
-
bioRxiv - Cell Biology 2020Quote: cDNA was amplified with primers listed in Primers and sequences section of methods with Q5® High-Fidelity DNA Polymerase PCR System (NEB). PCR conditions ...
-
bioRxiv - Immunology 2021Quote: ... was isolated from cDNA of devil peripheral blood mononuclear cells (PBMCs) by PCR using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genetics 2021Quote: ... pUASTattB-3xHA::amxFL described above was used as a template to amplify and add appropriate homology arms to the SS-3xHA::Amx DNA sequence with the primers 5’- CCCCGCTCTATCTGACCAAAGCCACCATGAGGCTCCAACGAC-3’ and 5’- AAAACTAAACTAAGAACGGACTACTATATGTAAAGTGAGCCATCCGC-3’ using Q5® High-Fidelity 2X Master Mix (M0492S, NEB). The section of pattB-amx plasmid containing the amx regulatory elements was linearized by PCR using Q5 polymerase and primers 5’- CGTTGGAGCCTCATGGTGGCTTTGGTCAGATAGAGCG-3’ and 5’- GCTCACTTTACATATAGTAGTCCGTTCTTAGTTTAGTTTTACAGGGGT-3’ ...
-
bioRxiv - Genetics 2021Quote: Vector backbones were obtained by restriction digest and component parts for vector inserts were generated by PCR from synthesised DNA or existing vector templates using Q5® High-Fidelity 2X Master Mix (NEB). Vector components were purified using the Monarch® DNA Gel Extraction Kit or the Monarch® PCR & DNA Cleanup Kit (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lyrata respectively using 0.2 µM primers designed against ASY3 cDNA sequences obtained above (S5 Table) and Q5® High-Fidelity DNA Polymerase (New England Biolabs). PCR conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We then digested 1µg of genomic DNA using the high-fidelity restriction enzyme SbfI-HF (New England BioLabs, catalog number R3642L), followed by MspI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genotyping of the embryos was performed from the fin clip biopsies with Q5® High-Fidelity DNA Polymerase (New England Biolabs) as stated above ...
-
bioRxiv - Developmental Biology 2020Quote: Alg2 cDNA was amplified with RT-PCR from the cDNA of wt Oryzias latipes Cab strain stage 18 embryos with Q5® High-Fidelity DNA Polymerase (New England Biolabs) by using primers with BamHI-HF (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: Each Mmp13 promoter sequence was amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, NEB, Ipswich, MA, USA). To generate luciferase constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplification of libraries was performed with Q5 High-Fidelity DNA Polymerase in 25 μL according to the manufacturer instructions (New England BioLabs, NEB) with 10 cycles of amplification.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA substrates for in vitro cleavage represent fragments of human mitochondrial DNA amplified by PCR in Q5® High-Fidelity 2X Master Mix (M0492L, NEB). As a template ...
-
bioRxiv - Molecular Biology 2020Quote: ... using BamHI and NdeI sites added on mCherry during PCR amplification with the Q5® High-Fidelity DNA Polymerase (NEB, #M0491). The pBabe-H2B-GFP plasmid (Addgene #26790 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mcr-1 gene along with its natural promoter was PCR-amplified from the natural PN16 (IncI2) plasmid using Q5® High-Fidelity DNA Polymerase (New England BioLabs). The amplified and purified mcr-1 fragment was assembled together with PCR-amplified pSEVA121 backbone using NEBuilder® HiFi DNA Assembly Master Mix according to the manufacturer’s instructions ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... and 18 μl of purified DNA was used as template in a 30 μl HiScribe T7 Quick High Yield RNA Synthesis reaction (NEB E2050S) following the protocol for short templates and incubated overnight at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... The tagmented cDNA was then amplified with barcodes using the Phusion High Fidelity PCR master mix (New England Biolabs cat# M0531L). The amplification program was set to 1 ...
-
bioRxiv - Genomics 2020Quote: ... was amplified as per the ChIPmentation protocol [64] using indexed and non-indexed primers and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541) in a thermomixer with the following program ...
-
bioRxiv - Physiology 2019Quote: ... The obtained 20-nt sequences were incorporated into a DNA oligonucleotide template containing a T7 promoter and a sgRNA scaffold by overlapping PCR using Phusion high fidelity DNA polymerase (New England Biolabs, M0530). The primer sequences for overlapping PCR were as previously described11 including the designed sgRNA sequences ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 μl of the supernatant was used as the PCR template in a 20 μl-reaction with Q5 High-Fidelity DNA Polymerase (New England Biolabs, US). Lastly ...
-
bioRxiv - Genomics 2019Quote: ... After that tagmended library (20 µL) was PCR amplified using 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, #M0541L), 2.5 µL of P5_BRB primer (5 µM ...
-
bioRxiv - Microbiology 2019Quote: ... Zip codes were amplified from 100 ng of genomic DNA using primers flanking the zip code region (primers: 5‘-NNACGAAGACAAGATATCCTTGATC-3’ and 5’-NNTGTGTGGTAGATCCACATCG-3’) using Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Immunology 2019Quote: ... The ITS2 region was amplified and Illumina adapters appended by PCR in 25 ul volume with Q5 High-Fidelity 2X master mix (NEB, # M0492L). PCR conditions were as follows ...
-
bioRxiv - Microbiology 2020Quote: PCR amplification was performed using 2 μl of the diluted cDNA in a 25 μl reaction mix containing 0.02 U of Q5® High-Fidelity DNA Polymerase (NEB, Germany), 200 μM of dNTP ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and a PCR product of about 300 nucleotides from a coding sequence was than amplified by PCR using Q5® High-Fidelity DNA polymerase (New England Biolabs). The resulting PCR products were gel purified ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Full length cDNAs were amplified using Q5 High Fidelity DNA polymerase in mastermix format (New England Biolabs Inc., Ipswich, MA, USA). The 50µL reactions contained 25ng cDNA ...
-
bioRxiv - Genomics 2019Quote: ... flanking the crRNAs cutting sites of Slit2 locus and pUC empty vector were amplified by Q5® Hot Start High-Fidelity 2X Master Mix (Cat. M0494S, NEB) from mouse tail genomic DNA and pX330 plasmid (Cat ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each potential sgRNA off target site listed in Table S2 (off-target score provided by Benchling) was screened by High-Fidelity PCR (Q5 NEB, M0491L) with primers listed in Table S5 and PCR products were sequenced using Eurofins Genomics tube DNA sequencing services ...
-
bioRxiv - Immunology 2020Quote: ... Target DNA was amplified from a cDNA template or existing plasmids using primers and PCR conditions shown in Tables S2-S4 using Q5 High-Fidelity 2X Master Mix (New England Biolabs # M0494L). Primers were ordered with 5’ base extensions that overlapped expression vectors on either side of the restriction sites ...
-
bioRxiv - Genomics 2020Quote: ... were dispensed at 35nL in wells that contained single cells followed by two dispenses of 50nL (100nL total) 2x NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L). The chip was sealed and spun down at 2250xg for 3 mins after each dispense ...
-
bioRxiv - Systems Biology 2021Quote: ... The Ni-elution was collected directly on a pre-equilibrated amylose column (amylose high flow resin, New England Biolabs, Ipswich, Massachusetts). Amylose column was washed with 5 column volume cold wash buffer before fractionated elution in a buffer containing 25 mM Hepes pH 7.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... we generated DNA template for transcription of a new batch sgRNA (separate from that used for validation) by annealing two partially overlapping PCR primers (IDT, PAGE purified) and extending with NEBNext High-Fidelity polymerase (NEB, M0541S). We then transcribed each sgRNA in vitro using the HiScribe T7 Kit (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Successful generation of ΔpufX and ΔpufY strains was confirmed using PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, UK) and DNA sequencing (Eurofins).
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...