Labshake search
Citations for New England Biolabs :
1501 - 1550 of 2293 citations for Mouse D7ERTD443E shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... all restriction enzyme digested plasmids were treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs, Inc., Cat. No. M0290S) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... as per the manufacturers protocol and co-transformed into CEN.PK2-1C with pRS425 episomal plasmid backbone digested with SfoI and SacI (NEB). The assembled plasmid was extracted from S ...
-
bioRxiv - Immunology 2020Quote: ... The ligated plasmids pAF217 and pAF218 were then transformed into NEB® Stable Competent Escherichia coli (High Efficiency) (NEB). Single colonies were selected ...
-
bioRxiv - Molecular Biology 2019Quote: All plasmids were linearized with NotI and transcribed in vitro using the HiScribe(tm) T7 ARCA mRNA kit (NEB). mRNA was purified using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... all sequences between transposable elements of a p2T plasmid were removed by restriction digestion using AleI and EcoRI (NEB). The TetO-eGFP-HygroR cassette was created by amplifying each subunit individually from already excising constructs ...
-
bioRxiv - Cell Biology 2020Quote: ... Duplexed ultramers were diluted 1:100 in molecular biology grade water and ligated to digested plasmid using NEBuilder HiFi DNA assembly master mix as per manufacturer’s instructions (New England BioLabs). Plasmids were transfected into NEB5α bacteria and verified by Sanger sequencing.
-
bioRxiv - Synthetic Biology 2021Quote: ... To this end pCANTAB6_VhhTD4 plasmid (Supplementary Fig. S2) was used as DNA template for PCR using Q5 DNA polymerase (NEB) in three different reactions each containing the oligos 1 and 2 (for H107Y) ...
-
bioRxiv - Genomics 2019Quote: ... We then cloned all three libraries into the pGL4.23c plasmid using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: All plasmids used in this study were assembled by USER™ (uracil-specific excision reagent) cloning (New England Biolabs). Biobricks constituting promoters ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Cell Biology 2019Quote: ... The GFP-Rab5C PCR product and a pLXIN-I-NeoR plasmid were digested using Hpa1 (New England Biolabs – R0105) and Not1 (New England Biolabs – R3189 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... From the resulting plasmid a fragment containing CRE-bGH-poly(A) was excised with restriction enzymes SalI (NEB, R3138S) and AleI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transcription template for RNAI was produced by using p770 plasmid (from E. coli strain LK_2385) as template for PCR amplification using Q5 polymerase (NEB) and LK_3413 and LK_3414 primers to introduce a T7 class II promoter (Supplementary table 3) ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA was first cut by mixing the plasmid with a 10x digestion buffer (NEBuffer; Biolabs; Ipswich, MA, USA), a 10x EcoRI restriction enzyme (Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... PfPPRD-HA-TetR-DOZI and PfPPRD-TetR-DOZI plasmids were linearized with EcoRV (New England BioLabs, Ipswich, MA, USA). The RNA guide (gRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10-20 μg plasmid DNA was incubated with SssI (2.5 U/μg plasmid DNA) in the presence of 160 μM S-adenosylmethionine (SAM; New England Biolabs) for four hours at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... The products of the HiFi reaction were transformed into either NEB10β (for chlamydial transformation plasmids) or NEB5αIq (for BACTH) competent cells (NEB) and plated on appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2020Quote: ... we cloned the eGFP plasmid by restricting the pEGFP-RNASEH2A using HincII (New England Biolabs, Radnor, PA, cat # R0103S) that cut upstream and downstream of the RNASEH2A gene but leaves the EGFP intact ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB). The pSG1164 plasmid integrates at the native locus of the corresponding gene by a single-crossover event ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB). The pSG1164 plasmid integrates at the native locus of the corresponding gene by a single-crossover event ...
-
bioRxiv - Biophysics 2022Quote: ... and inserted to desired positions into the pCDNA.3.1-mPIEZO1 plasmid using High-Fidelity DNA Assembly (New England Biolabs). The presence of cpGFP inserts was confirmed by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Biophysics 2022Quote: ... Both RBPs presented (PCP and QCP) were cloned into the RBP plasmid between restriction sites KpnI and AgeI (NEB, catalog ...
-
bioRxiv - Molecular Biology 2022Quote: ... The new construct was created from a PCR reaction that amplified the entire plasmid harbouring the substitution using the high-fidelity polymerase Q5 according to the manufacturer’s instructions (New England Biolabs; NEB). The unpurified PCR product was then treated with DpnI to digest the methylated template DNA which was subsequently transformed into DH5α ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Genetics 2022Quote: All of the plasmids created by Gibson assembly used the NEBuilder HiFi DNA Assembly kit (New England Biolabs, #E2621). To construct the URA3 RRM3 plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... The nrVL4619 genome was excised and separated from its plasmid backbone using BsaI-HFv2 (New England Biolabs catalog # R3733) and PvuI-HF restriction enzymes (New England Biolabs catalog # R3150) ...
-
bioRxiv - Microbiology 2022Quote: ... The ligation of the digested insert into the recipient plasmid was performed using T4 DNA ligase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... All plasmids (Table S4) were constructed using the Gibson isothermal assembly method (NEBuilder HiFi DNA assembly master mix, NEB) and electrotransformed into E ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA fragments were inserted into plasmid vectors using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Massachusetts, USA). The primers used in this study are listed in the Supplemental Table S9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pCMV-PE4max with MluI restriction site and the pLV-PE plasmid were both digested by MluI (NEB #R0198L) and NotI (NEB #R0189L) ...
-
bioRxiv - Physiology 2022Quote: ... The scAAV-CMV-GFP plasmid was digested with EcoRI and HpaI (New England Biolabs; Cat. Nos. R3101 and R0105) and the linearized scAAV-CMV plasmid without the GFP was gel purified ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant plasmids encoding a catalytically inactive 3Dpol (3Dneg) were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). Nucleotides at position 6891 and 6892 of the CVB3/28 genome were mutated from AT to GC ...
-
bioRxiv - Microbiology 2023Quote: ... A pOUPc plasmid (e.g., pOUPc-UL148HA, ref: [94] was linearized by double-digested with MluI-HF (NEB Cat#: R3198L) and AgeI-HF (NEB Cat# ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid transformation was achieved by using the heat shock method (42°C, 47s) in DH5α competent cells (NEB, C2987H), then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into pTM1 (a pDONR/Zeo based plasmid) downstream of the ACT1 promoter using Gibson cloning kit (NEB), and then introduced into pDG33 using Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gαi2R179C and GαoAR243H mutants were constructed using pcDNA3.1 wild-type human ee-tagged-Gαi2- and ee-tagged-GαoA plasmids as template (cDNA Resource Center) and Q5 Site-directed mutagenesis kit (New England BioLabs). The lentiviral vector for tetracycline-inducible expression of the Gαi2R179C and GαoAR243H mutants was constructed by first cloning Gαi2R179C and GαoAR243H from pcDNA3.1 to pENTR vector (Thermofisher Scientific ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were constructed using the NEBuilder HiFi DNA assembly strategy of New England Biolabs (NEB, Frankfurt am Main, Germany)55 ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR fragments were inserted into the plasmid pG+host9 digested with PstI (New England Biolabs, Ipswich, Massachusetts, USA) by Gibson Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Construction of the PRP18/pUG35 and PRP18/YEp24 base plasmids was accomplished using Gibson assembly43 (New England Biolabs #E2611). Unless otherwise indicated in the figure legends ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligation of the plasmid was carried out via Gibson assembly as per manufacturer’s instructions (New England Biolabs; catalog # M5520AA2) and transfected into NEB5alpha bacteria ...
-
bioRxiv - Developmental Biology 2023Quote: ... The reporter HLC plasmid (20ng μl-1) was digested by 0.5 U I-Sce enzyme in its adequate digestion buffer (NEB) for 30’ at 37°C prior to injections ...
-
bioRxiv - Biochemistry 2023Quote: ... In a 50 μL reaction 1 μg of backbone plasmid (starting_eGPARK2iM) was digested at 37 °C for 1 hour with MluI-HF and EcoRI-HF (New England Biolabs), then heat-inactivated at 65 °C for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... nLuc plasmids were linearized using SpeI and subjected to in-vitro transcription using HiScribe T7 kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... to generate the synthetic enhancer eGFP plasmid reporter (pTol2-synthetic enhancer-E1b-eGFP-Tol2) using HiFi DNA Assembly following manufacturer’s instructions (New England Biolabs). Reporter plasmid sequences were verified by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: Plasmids containing the “circularization cassettes” were generated by using NEBuilder HiFi DNA Assembly Cloning Kit (#E5520S; New England BioLabs) and KLD Enzyme Mix (#M0554S ...
-
bioRxiv - Biophysics 2023Quote: To construct the circular DNA for AFM experiments we used a commercially available pGGA plasmid backbone (New England Biolabs). We linearized the plasmid using MT032 and MT033 primers (Table S2) ...
-
bioRxiv - Microbiology 2023Quote: ... These oligonucleotides were annealed together and the insert was cloned into pRH2521 plasmid using the BbsI restriction enzyme (NEB) and E ...