Labshake search
Citations for New England Biolabs :
1051 - 1100 of 1210 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... A polyadenylated fraction was purified from the total RNA (1 µg) using the NEBNext® Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). This fraction was used to construct cDNA library using a previously described method [91] ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Zoology 2024Quote: ... The annealed dsRNAs (2.5 µg) were checked on 1.5% agarose gel by running them together with 2 µL of dsRNA ladder (NEB# N0363S, Germany) (Fig ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... Whole-cell extracts were quantified using the BCA assay and 10 µg was subjected to PNGase F (New England Biolabs, #P0705S) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 units of RNase H were added per µg of DNA with 1x RNase H buffer (New England Biolabs, Ipswich, MA); for DNase I treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... Poly(A)-tailing was performed by mixing 1 µg of DNase-treated total RNA with the following reagents: 2 µL of poly(A)-tailing buffer (NEB, #B0276SVIAL), 2 µL of 10 mM ATP (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 µg of each lysate in 2X Laemmli buffer containing DTT/BPB was combined with GlycoBuffer 2 (1X final; NEB, P0704S) and NP-40 (1% final ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were constructed using 0.4 µg of RNA and the NEBNext ® UltraTM RNA Library Prep Kity for Illumina (NEB, USA). mRNA was purified via poly-T magnetic beads ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... Synthesized modRNA was column purified and eluted with 60 µL water using the 50 µg Monarch RNA Cleanup Kit (New England Biolabs, T2040). A small sample was nanodropped and ran on a native denaturing gel to determine modRNA concentration and verify full-length product ...
-
bioRxiv - Biophysics 2024Quote: ... The 12-mer mixture was ligated in the final concentration of 0.3-0.52 µg/µL (fixed to the same concentration for the same batch) with 133U/µL T4 ligase (New England Biolabs, M0202M) and 50mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was purified with Silane beads and eluted in 52 μl of RNase free H2O as input for end repair reaction using End Repair Module (NEB) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... Shotgun sequencing was performed using a PCR-free DNA library preparation (NEBNext Ultra II DNA Library Prep Kit, New England Biolabs). Libraries were paired end 150 bp sequenced with Illumina HiSeqX ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification-free indexed Illumina libraries were prepared (9) using the NEBNext Ultra II DNA Library Prep kit (New England BioLabs). The libraries were quantified using the Accuclear Ultra High Sensitivity dsDNA Quantitative kit (Biotium ...
-
bioRxiv - Genomics 2022Quote: ... Full-length L1s were then reconstructed by combining PCR-mutation free fragments from different clones using restriction enzymes (New England Biolabs) recognizing the L1 sequence ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the reaction was purified with the Monarch RNA Cleanup Kit (500 micrograms) with elution in 50 µl nuclease-free water (NEB). The quality of the gRNA prep was confirmed by agarose gel electrophoresis and quantified using a NanoDrop One (Thermo Fisher).
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were labelled by replacing complete growth medium with 500 μl serum free DMEM/F12 containing 200 nM SNAP Surface Alexa Fluor-488 (New England Biolabs) and were incubated for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: 10 μg of >200nt RNA (in nuclease-free water) was decapped using 200 U yDcpS and yDcpS buffer (NEB, #M0463S) at 37°C in a thermomixer at 800rpm pulse shaking ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Microbiology 2022Quote: ... 4.5 μg of RCA material was diluted in 65 μL of nuclease-free water and treated with 2 μL of T7 endonuclease I (New England Biolabs) for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Genomics 2024Quote: ... undergoes a reduced and customized fragmentation/end-repair/A-tailing reaction for Illumina-compatible PCR-free library construction with custom NEBNext Ultra II FS DNA Library Preparation Kits (New England Biolabs) using the following conditions (37℃ for 42.57 min ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
Analysis of natural structures and chemical mapping data reveals local stability compensation in RNAbioRxiv - Biophysics 2024Quote: ... primers were diluted 1:10 to 10 μM in RNase-free water.The PCR reaction contained 25 μL Q5 High-Fidelity DNA Polymerase (New England Biolabs #M0494S), 5 μL each of diluted forward and reverse primers ...
-
bioRxiv - Evolutionary Biology 2024Quote: The mRNAs for cell-free protein expression were transcribed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of RNA for each sample was treated with DNase I at 37°C for 10 minutes (New England Biolabs) and 0.5 µg was used for reverse transcription with the GoScript Reverse Transcription Mix ...
-
bioRxiv - Microbiology 2021Quote: ... Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C and the clarified extract was loaded onto a chitin resin (NEB) column pre-equilibrated with column buffer for purification at RT ...
-
bioRxiv - Biochemistry 2022Quote: 4µg of pPNL6 vector in Cut Smart buffer was digested using 1µl of NheI HF and BamHI HF (NEB Biolabs) at 37°C for 1h ...
-
bioRxiv - Plant Biology 2020Quote: ... The supernatant was collected after a spin at 16000 g for 30 min and incubated with GFP-Trap (Chromtek) or MBP magnetic beads (NEB) for 3 h at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... mutations were inserted into the open reading frame of Vesicular stomatitis virus glycoprotein VSV-G using the Q5 SDM kit (NEB). Myc epitope-tagged SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded cDNA was synthesized from 10 µg of RNA using 100 pM random hexamer primer (Integrated DNA Technologies) and M-MuLV Reverse Transcriptase (New England Biolabs). After reverse transcription ...
-
bioRxiv - Biophysics 2020Quote: ... The lysate was cleared from cell debris by centrifugation at 50000 g for 1 hour followed by incubation with Amylose resin (NEB) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of tissue or cell lysates were treated with or without 2 μL Lambda Protein Phosphatase (LPP) (New England Biolabs) at 30 °C for 15 min (30 min for HEK-293E lysate ...
-
bioRxiv - Microbiology 2022Quote: ... and poly(G) tails were added at the 3’ end of the purified ssDNA by terminal transferase (New England Biolabs). The double-stranded DNA was then synthesized and amplified by PCR from the poly(AG)-tailed ssDNA using the primers BLV-F2 and NV-oligo-dT-ADP1 and Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... or used as a template to generate chimeric fimbrial gene clusters containing different G adhesins using the T4 DNA ligase (NEB). PCR fragments containing G adhesin genes were obtained using primer pairs CMD2171_F and CMD2172_R (for papG class I from strain J96) ...
-
bioRxiv - Cell Biology 2020Quote: ... The internal EcoRI site was disrupted by introducing at silent mutation at nt1283 (G to A) using Q5 site directed mutagenesis (NEB) and mTimm50-mRFP was cloned in to pQCXIN (Clontech #631514 ...
-
bioRxiv - Immunology 2020Quote: ... 1μg RNA from each sample was used for mRNA enrichment using NEBNext Poly(A) mRNA magnetic isolation module (E7490S, NEB). RNA-seq libraries were constructed using the purified mRNA samples with NEBNext Ultra II Directional RNA library Prep Kit for Illumina (E7760S ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 μg of pSCW01 plasmid was treated with 1.5 units/μg of site specific endonuclease Nt.BstNBI (New England Biolabs, Ipswitch, MA) and 100X molar excess of displacer oligonucleotides (DNA197-199 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and subsequently cloned via Gibson Assembly in the pRRL-EF1a-XhoI-IRES-BlastR plasmid (gift from G. Superti-Furga) using the NEBuilder HiFi DNA Assembly Mix (New England Biolabs). The CRBN/VHL WT and point mutant plasmids were used for lentivirus production and subsequent transduction in RKO CRBN-/- and VHL-/- clones respectively.
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...