Labshake search
Citations for New England Biolabs :
1001 - 1050 of 1210 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Synthesized modRNA was column purified and eluted with 60 µL water using the 50 µg Monarch RNA Cleanup Kit (New England Biolabs). A small sample was nanodropped and ran on a native denaturing gel to determine RNA concentration and verify full-length product ...
-
bioRxiv - Neuroscience 2024Quote: ... we prepared DNA standards by linearizing 20 µg of the respective transfer plasmid with the restriction enzyme ScaI (catalog number R3122S, New England Biolabs), then ran the product on a 0.9% agarose gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed capping fragments were now ligated to linearised pUber using T4 DNA ligase (100 Units per µg of DNA, New England Biolabs) in 1xCutSmart supplemented with 1 mM ATP and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Linearization was performed by overnight digest at 37C° of 10 µg of donor plasmid using 20 Units of PaqCI (R0745, NEB) in 1x rCutSmart buffer (B6004S ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of RNA was reverse transcribed using the ProtoScript II Reverse transcriptase kit from New England Biolabs (NEB #M0368S) and primed with oligo dT ...
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 µL of reaction mixture containing 1 µg of template was prepared for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We incubated 1 µg of DNA origami nanoparticle with 1 U/µL DNase I (2,000 units/mL, New England Biolabs, M0303S) with 10× DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 min of incubation at 37 °C the products of digestion were analyzed with PAGE directly or isolated from the reaction mixture using Monarch RNA cleanup kit (10 µg, NEB).
-
bioRxiv - Molecular Biology 2021Quote: 1 μg of total RNA (DNase treated) was reversed transcribed using random hexamers according to manufacturer’s instructions (Protoscript II, NEB); cDNA diluted to 50uL ...
-
bioRxiv - Cell Biology 2021Quote: ... centrifuged at 58,000 × g for 50 minutes at 4°C and the protein was batch purified using chitin beads (NEB). Protein-bound chitin beads were washed with lysis buffer and high salt buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: 100μg of each P13 and P40 sample was resuspended with 20μL of 1X glycoprotein denaturing buffer (New England BioLabs) and incubated at 100°C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and protein was purified on amylose resin (NEB) including a high salt wash with buffer containing 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biophysics 2020Quote: ... we first optimized the wb-WC reaction path in G○U in gas phase using nudged elastic band (NEB) method at B3LYP-D3BJ/def2-TZVP level (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was isolated by centrifugation at 90,000 g for 35 min and the solubilized complex was incubated with amylose resin (NEB) for 2.5 h at 4 C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was isolated by centrifugation at 90,000 g for 35 min and the solubilized complex was incubated with amylose resin (NEB) for 2.5 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... the nuclei were pelleted and supernatants were transferred to 2.0 ml screw-top tubes with O-rings containing magnetic beads (SureBeads Protein G Magnetic Beads, NEB) coupled to antibodies (anti-pan Ago antibody ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were centrifuged for 15 min at 30,700 x g and the collected supernatants were incubated with amylose resin (New England Biolabs) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: One microgram of the PCR product and 10 μg of the pDX_init vector 46 were digested separately with 50 units of BspQI (Cat. R0712L, New England Biolabs) for 1.5 h at 50 °C before heat inactivation at 80 °C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... without codon optimization and was inserted into pcDNA 3.1 to g et pcDNA 3.1-SARS-CoV-2-Spike using NEBuilder® HiFi DNA Assembly Master Mix (NEB) a ccording to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Isolated genomic DNA was G-tailed at random DNA breaks using dGTP together with terminal transferase (NEB cat M0315S) and used as template for nested PCRs using G-tail specific primer bap2pc (5’- gtccagagccgtccagcaacccccccccccccc-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNAs were capped co-transcriptionally during the T7 RNA polymerase reaction by decreasing GTP to 0.125 mM with addition of 2.5 mM cap analog (G-cap, NEB S1407S; A-cap, NEB S1406S).
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pelleted at 500 x g for 5 minutes and resuspended in 8µg/mL recombinant albumin (New England Biolabs) in dPBS-/- ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 μl of 0.1∼1 μg genomic DNA was mixed with 10 μl of 2X C-circle master mix [0.2 mg/ml BSA (NEB), 0.2% Tween-20 ...
-
bioRxiv - Molecular Biology 2023Quote: Purified and concentrated mTAAR7f was mixed with about 10x molar excess of both the heterotrimeric G protein and Nb35 and 0.5 U apyrase (NEB) and incubated overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was clarified by centrifugation at 100,000 × g for 30 min and incubated with amylose affinity resin (New England BioLabs). Resin was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysate was clarified by centrifugation at 100,000 × g for 30 min and incubated with amylose affinity resin (New England BioLabs). Resin was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5 μg each of vector pNeae2.1 and insert DNA were combined with 5 μL of 10x T4 Ligase Buffer (NEB), 5 μL of 10x rCutSmart Buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... following the manufacturer’s instructions and 3′-O-Me-m7G(5′)ppp(5′)G RNA cap (New England Biolabs, USA) was used as the cap structure analog ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was purified with Silane beads and eluted in 52 μl of RNase free H2O as input for end repair reaction using End Repair Module (NEB) following manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... Shotgun sequencing was performed using a PCR-free DNA library preparation (NEBNext Ultra II DNA Library Prep Kit, New England Biolabs). Libraries were paired end 150 bp sequenced with Illumina HiSeqX ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification-free indexed Illumina libraries were prepared (9) using the NEBNext Ultra II DNA Library Prep kit (New England BioLabs). The libraries were quantified using the Accuclear Ultra High Sensitivity dsDNA Quantitative kit (Biotium ...
-
bioRxiv - Genomics 2022Quote: ... Full-length L1s were then reconstructed by combining PCR-mutation free fragments from different clones using restriction enzymes (New England Biolabs) recognizing the L1 sequence ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the reaction was purified with the Monarch RNA Cleanup Kit (500 micrograms) with elution in 50 µl nuclease-free water (NEB). The quality of the gRNA prep was confirmed by agarose gel electrophoresis and quantified using a NanoDrop One (Thermo Fisher).
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were labelled by replacing complete growth medium with 500 μl serum free DMEM/F12 containing 200 nM SNAP Surface Alexa Fluor-488 (New England Biolabs) and were incubated for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... 4.5 μg of RCA material was diluted in 65 μL of nuclease-free water and treated with 2 μL of T7 endonuclease I (New England Biolabs) for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: 10 μg of >200nt RNA (in nuclease-free water) was decapped using 200 U yDcpS and yDcpS buffer (NEB, #M0463S) at 37°C in a thermomixer at 800rpm pulse shaking ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... undergoes a reduced and customized fragmentation/end-repair/A-tailing reaction for Illumina-compatible PCR-free library construction with custom NEBNext Ultra II FS DNA Library Preparation Kits (New England Biolabs) using the following conditions (37℃ for 42.57 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.