Labshake search
Citations for New England Biolabs :
901 - 950 of 1210 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... We generated sequencing libraries using the TruSeq DNA PCR-Free Sample Preparation Kit (New England Biolabs, Massachusetts, USA), which were sequenced using the Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Microbiology 2024Quote: ... cell-free transcription-translation assays were carried out using the PURExpress® In Vitro Protein Synthesis Kit (NEB) following the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2024Quote: Libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (PCR Free Library) (New England Biolabs). Sequencing was performed in the NovaSeq 6000 System (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from 0.5-1 µg of RNA per sample using Protoscript II RT and Random Primer Mix (New England Biolabs). qPCR reactions were performed on cDNA using iQ SYBR Green supermix (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... 107 epimastigotes were electroporated with 2.5 µg of pTRIX2-GFP plasmid (Fig 1 A) linearized with AscI and SacI (NEB). The plasmid had been derived from pTRIX-REh9 [28] ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ten µg of total RNAs was subjected to RNA purification using DNase I as described (NEB, cat. no. M0303) and quality was checked on 2% agarose gel ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the IVT template RNA (0.01– 0.05 A260 units) was digested into nucleosides using 10 µg/ml nuclease P1 (New England Biolabs, M0660S), and 0.5 U/ml Bacterial Alkaline phosphatase (Takara 2120A ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Physiology 2022Quote: ... mRNA was isolated from purified 1 µg total RNA using oligo-dT beads (New England Biolabs, Ipswich, MA, US) and fragmented in reverse transcription buffer by incubating at 85 °C for 7 min ...
-
bioRxiv - Biochemistry 2022Quote: ... The samples were treated with 25 µg Proteinase K (1.25 µL of 20 mg/mL stock solution, New England Biolabs) and incubated at 50 °C for 20 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The total isolated gDNA was processed in batches of 5 µg per PCR reaction with Q5 polymerase (NEB M0491L). One PCR reaction contained 10 µl 5x reaction buffer ...
-
bioRxiv - Molecular Biology 2022Quote: 1 µg total RNA was used for mRNA purification with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, E7490). From purified mRNA ...
-
bioRxiv - Systems Biology 2024Quote: ... the cDNA was diluted to 0.05 µg/ml and PCR-amplified using Phusion DNA polymerase (New England Biolabs M0530) with 0.5 mM dNTPs ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized from 1 µg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with d(T)23VN primer.
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total cDNA for RT-qPCR was generated from 1.5 µg total RNA using a random primer mix and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼40 µg of bulk RNA was subjected to poly(A) selection using Oligo d(T)25 magnetic beads (NEB) followed by on-bead 5’ ligation of a biotinylated REL5 linker sequence using T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA (10 µg) was fragmented by using 5 units of ShortCut RNase III (New England Biolabs, M0245) for 5 min at 37°C and the reaction was stopped by adding 10 µL nuclease free water ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM MgCl2, 1% CHAPS,2.5 mM DTT, 50 µg/mL cycloheximide, 20 U RNase inhibitor murine, New England BioLabs, EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Biophysics 2023Quote: A 2070-bp DNA handle was amplified by PCR from λ DNA template (final 2.5 µg/ml; NEB, N3011S) using a forward primer (TAAGGATGAACAGTTCTGGC ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 µg/mL recombinant albumen at pH 7.9; New England Biolabs) and 0.75 µL DpnI (New England Biolabs) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg of the plasmids containing the reporters and promoters (pJL206 or pJL261) were linearized with BciVI (NEB, R0596S) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... plus 100 µg/mL BSA) and A-tailed (30 min 37°C; NEBNext® dA-Tailing Module; NEB, E6053L) with intervening CutsmartTM washes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of small RNA was reacted in a final volume of 20 µL with 1x Heparinase Buffer (NEB) and 0.5 µL of each of the three heparinase enzymes described above ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) or GST-fusion proteins for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Total lysates (200 µg each) were incubated with or without 400 U lambda protein phosphatase (New England Biolabs, #P0753S) and 1 mM MnCl2 at 30 °C for 30 min ...
-
bioRxiv - Genomics 2024Quote: ... was utilized using 1 µg gDNA and the pre-annealed NEB adapter (NEB_P7, NEB_P5, 15 µM; Supplementary Table 1). The manufacturer’s instruction was followed without performing the USER enzyme step ...
-
bioRxiv - Genomics 2024Quote: ... was mixed with 4 µg gDNA (or a sample from previous blocking/repair step) in 1x NEBuffer 2 (NEB) in a final volume of 20 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µg of pUC19 was cleaved with EcoRI and labeled at the 5′ ends using T4 polynucleotide kinase (NEB) with [γ-32P]-ATP or at the 3′ ends using Klenow (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... RNA libraries were constructed according to standard protocol using NEB Next® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England Biolabs, MA, USA). Ribosomal RNA depletion was carried out using Ribo-zero rRNA Removal Kit ...
-
bioRxiv - Genomics 2022Quote: ... The RNA samples and standards were amplified using the Luna® Universal Probe One-Step RT-PCR Kit (E3006, BioLabs®Inc, Ipswich, Massachusetts, USA), with 0.6 mM primer and 0.2 mM probe concentrations (Table S4) ...
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries for good quality samples (total DNA amount > 20 ng) were prepared with the standard NEBNext®Ultra™ II DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA), while double stranded libraries for the samples extracted in the ancient DNA laboratory were prepared following the Meyer and Kircher protocol67 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SWS point mutation of G to A was generated using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with primers 5’-CATCCAGCGCaGGGTGACAAG-3’ and 5’-TCCTGGAAGGTGGTGGCA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysis was cleared by centrifugation at 16,100g for 10 min and 0.65 ml supernatant was mixed with 50μl Protein G beads (NEB, #37478S) pre-conjugated to U1-70K antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 25μg of gDNA (5μg per crRNA pool) was diluted in 15.6μl 10X CutSmart® Buffer (New England BioLabs) and 15.6 μl Calf Intestinal Phosphatase (5U/μl ...
-
bioRxiv - Genetics 2021Quote: ... each DNA sample was digested with ApeKI (recognition site: G|CWCG; New England Biolabs Inc., Ipswich, MA, USA), then ligated to a unique barcoded adapter ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Microbiology 2020Quote: ... IVT gRNA was produced from SFV infectious clone plasmid and treated with 10 U of DNase1 (RNase-Free; NEB) for 30 min at 37°C before purification with the RNeasy MiniElute Cleanup kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB], 0.02% RNAse-free BSA [NEB] ...
-
bioRxiv - Zoology 2020Quote: ... The RNA pellet was resuspended with 30 µl of DNase/RNase free water and digested with DNase I (NEB) following the manufacturer protocol ...