Labshake search
Citations for New England Biolabs :
9351 - 9400 of 9715 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the isolated RNA was used for cDNA library construction using the NEBNext Ultra RNA Library Preparation Kit for Illumina (New England Biolabs, Ipswich, MA, USA), with a fragment length of approximately 150 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... and one plasmid was randomly selected from those plasmids and used for expression with a PURE system (PURExpress In Vitro Protein Synthesis Kit, New England BioLabs, Ipswich, MA, USA).
-
Cryo-EM reveals disrupted human p97 allosteric activation by disease mutations and inhibitor bindingbioRxiv - Biochemistry 2021Quote: ... c.1774G>A (D592N) (see Table S1 for full list of primer sequences) using the Q5® Site-directed mutagenesis kit (New England Biolabs, MA, USA). Each mutant sequence was verified for insertion of the correct mutation using sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... One microgram of RNA from each pool was used for library preparation with the NEBNext® UltraTMRNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999) with an NEBuilder HiFi DNA Assembly kit (NEB, Ipswich, MA, USA).
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from four caudal fins per experimental point using a Monarch Total RNA miniprep kit (#T2010S; New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... samples were diluted in 10 μl of RNase-free water and 5 μl of the sample were used for RNA library construction using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Ribosomal RNA was firstly removed and a directional sequencing library was constructed using NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were prepared using NEBNext Poly(A) mRNA magnetic isolation modules and Ultra II Directional Library Prep kits (New England BioLabs, Inc, MA, USA) according to standard protocol ...
-
bioRxiv - Genomics 2021Quote: RNA-seq libraries were constructed at the ICBR Gene Expression & Genotyping Core Lab using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were prepped for high-throughput sequencing using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA strand synthesis and indexing were carried out using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) according to the supplier’s manual ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Molecular Biology 2021Quote: ... The digested products were separated by 0.8% agarose gel electrophoresis and purified using the Monarch® DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA, USA). The purified products were ligated using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared from ∼500ng of input or IP DNA using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) according to kit instructions ...
-
bioRxiv - Immunology 2021Quote: ... DNA oligomers with Golden Gate overhangs were annealed and subsequently cloned into the non-digested target plasmid using the NEB® Golden Gate Assembly Kit (BsmBI-v2, New England Biolabs cat E1602L). sgRNAs have been cloned into pXPR_502 (addgene 96923 ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were generated with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, Massachusetts) and subsequently sequenced in paired-end mode with 150- bp read length on a NextSeq500 to obtain ∼40 mio reads (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... and RNA sequencing was performed using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, E7760S) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was fragmented and TruSeq-Adapters ligated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina® (NEB) and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μl of which were transferred to a new tube and subjected to a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB #E7645), using half of the recommended reagents’ volumes ...
-
bioRxiv - Molecular Biology 2022Quote: ... AGTCCCCAGCACATAGAAGG hWISP1_negative_reverse: GGTTCTGAAGGTGACCGACT ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3-TNFR1 expression vector was generated by cloning with the primers indicated below to PCR amplify (using Q5 High-Fidelity PCR kit, New England Biolabs, Euroclone, Milan, Italy) the TNFR1 reference sequence from pBMNZ-neo-Flag-TNFR1 L380A (gift from Martin Kluger ...
-
bioRxiv - Cancer Biology 2022Quote: ... and bar-coded libraries were constructed using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich MA). Libraries were pooled and sequenced single-end (1×75 ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions to generate catalytic arginine point mutants for AIM18 and AIM46 were performed according to the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Table S2). SDM reactions were transformed into E ...
-
bioRxiv - Bioengineering 2022Quote: ... RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, Ipswich, MA) and then column purified ...
-
bioRxiv - Biochemistry 2022Quote: ... The two pairs of PCR products were ligated together by in vitro homologous recombination using a Gibson assembly cloning kit (NEB, Boston, MA, USA), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... full-length human MYO5 was cloned from the same cDNA library as above and inserted into the pHTN-HaloTag expression vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA synthesis was performed as a 20 μl reaction using the LunaScript® RT SuperMix Kit (NEB, following the manufacturer’s protocol) and cDNA was stored short-term at −20°C before transcriptional assessment.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Total RNA samples were subjected to library preparation using an NEB Next Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol (NEB #E7530) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared from 100 ng of DNA using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB E7805L) with NEBNext® Multiplex Oligos for Illumina® (E7600S) ...
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Microbiology 2022Quote: Meta3C sequencing libraries were generated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (NEB catalogue number #E6177) following the manufacturer’s protocol with barcoding of the MluCI and HpaII libraries with the NEBNext® Multiplex Oligos for Illuminia® (NEB #E7335) ...
-
bioRxiv - Microbiology 2022Quote: ... USA) containing the desired sequences were first cloned into pKD3 or pKD4 (contain R6Kγ origin) using Gibson Assembly (NEB Gibson Assembly Cloning Kit) and maintained in PIR1 E ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Lucia and Cypridina luciferase activity was quantified by bioluminescence from aliquots of the cell supernatant (BioLux Cypridina Luciferase assay kit, New England Biolabs; Quanti-Luc, InvivoGen). Reference plasmid-normalized luciferase activity was from the average of three independent transfections ...
-
bioRxiv - Plant Biology 2022Quote: ... A total of 0.5 μg of total RNA per biological replicate were used for preparing 150 bp paired-end (PE) read libraries using the NEBNext®Ultra™ II RNA Library Prep Kit (New England Biolabs, Inc.). Small RNA was extracted using a Plant miRNA kit (Omega Bio-tek Inc.) ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... Transcription-unit (TU) plasmids were assembled with promoters and terminators from the MoClo kit using high-fidelity BsaI restriction enzyme (NEB, Ipswitch, MA, USA)51 ...
-
bioRxiv - Microbiology 2023Quote: ... and metagenomic libraries were prepared using 50 ng of DNA and the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Ipswich, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: ... PCR amplified fragments were assembled with BamHI and SbfI linearized pUA139 using the NEBuilder HiFi DNA Assembly kit (New England Biolabs Inc., MA, USA) to generate pTE24G ...
-
bioRxiv - Neuroscience 2022Quote: RNA library preparations for transcriptome analysis were performed using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (New England Biolabs, #E6420) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... ligated to sequencing adapters and amplified using NEBNext® UltraTM II DNA Library Prep Kit for Illumina® and NEBNext Multiplex Oligos for Illumina® (New England Biolabs). The amplified DNA (around 275 bp in size ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation was performed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs E7760S) and paired end sequencing was performed on the Nextseq 550 platform (Illumina) ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram of total RNA was used to prepare each sequencing library with the NEBNext Ultra II Directional RNA library prep kit (New England Biolabs Japan, Tokyo, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Library preparation for RNA sequencing was performed using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, USA, Catalog #: E7530L), strictly adhering to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Amplified genes were purified by agarose gel electrophoresis and extraction with the Monarch DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA, USA). Both the synthesized genes and PCR amplified genes were then inserted into a doubly digested BamHI/XhoI pET28b(+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... beads and library preparation was carried out with the Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). The Illumina NovaSeq6000 platform was used for library sequencing ...
-
bioRxiv - Biochemistry 2024Quote: N-term-His-ELMO1C438A construct was generated from N-term-His-ELMO1 construct obtained above using Q5® Site-Directed Mutagenesis Kit (New England BioLabs, cat # E0554S), with the following primers.