Labshake search
Citations for New England Biolabs :
651 - 684 of 684 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplifications of rbcL sequences were performed with the RbcL-M-F and RbcL-M-R primers using PCR Ready Mix (BioLabs, Israel), and 50ng DNA-template ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 μg protein were denatured as above and adjusted to a final concentration of 1x Glycobuffer 2 containing 125U PNGase F per μg (NEB, P0704S) in 50 μl ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed with PBS and the cells were incubated in 1ml serum free medium and 250U/ml PNGase F (NEB, P0704S) for 6h ...
-
bioRxiv - Cancer Biology 2022Quote: In vitro transcription of LINC00313 or firefly luciferase (F-luc) mRNA was performed using the HiScribe™ T7 High Yield RNA Synthesis kit (New England Biolabs), according to the instructions by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: Proteins were reduced with 25 mM DTT and then alkylated with 40 mM iodacetamide prior to the addition of PNGase F at a final concentration of 1500 U (New England Biolabs, P0704) to achieve the removal of N-glycosylations ...
-
bioRxiv - Biochemistry 2022Quote: ... the sample was diluted to 50 μL with ammonium bicarbonate buffer and incubated at 37 °C with 2 μL of PNGase F (New England Biolabs P0705S) diluted 1:100 in ammonium bicarbonate for an additional 7 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genetics 2024Quote: ... 400 nM of each of the flanking primers PS1057-NGS-F and PS1057-NGS-R (S2 File) and 0.1 units/µl of LongAmp Taq DNA polymerase (NEB Cat. # M0323L). In a second amplification step ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... Whole-cell extracts were quantified using the BCA assay and 10 µg was subjected to PNGase F (New England Biolabs, #P0705S) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... or the ura3(R235A) strain (H06701) was isolated as described previously and used as template in a Phusion (New England Biolabs, Ipswich, MA) or Taq DNA Polymerase ((New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... Confirmation by Southern blot was accomplished by digesting the genomic DNA of the parental and putative deletion strains with AgeI (NEB, Ipswich, MA), separating the DNA fragments by gel electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: DNA encoding XFP1-10 protein was transformed and expressed under the control of an arabinose inducible promoter in Escherichia coli strain BL21(DE3) (New England BioLabs, Ipswich, MA). Cells were grown in Luria broth medium to an initial optical density of 0.2 ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA from wildtype animals (N2) and from strains bearing the hcp-6(mr17) mutation was amplified using a high-fidelity polymerase (Phusion®, NEB #M0530S) and the following primer pairs:
-
bioRxiv - Molecular Biology 2022Quote: ... Strains with chromosomal insertions were constructed by amplifying overexpression cassettes from previously constructed plasmids with Phusion polymerase (New England Biolabs, Evry, France) and oligonucleotides eo-chrXI-f and eo-chrXI-r (Supplementary materials) ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Biophysics 2021Quote: ... PNGase F was then removed by incubating the samples in chitin magnetic beads according to manufacturer instructions (New England Biolabs, Ipswich, MA). Deglycosylation of proteins was confirmed via sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... encoding a 7-mer insertion between amino acid residues 588 and 589 of AAV9 was used as the reverse primer along with the Assembly-Xbal-F oligo (CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5® High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid.
-
bioRxiv - Developmental Biology 2021Quote: ... touchdown PCR (with primers atg13 F- GGCTCGTGCGACAATGGATAGTG; R- GACCTCGGGGATGTCCTTTATTGC) was followed by a HindIII restriction digest (R3104S, New England Biolabs, MA, USA), and fragments were separated by gel electrophoresis on a 3% agarose gel ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples run under reducing and deglycosylating conditions were reduced by treatment of the samples with dithiothreitol (final concentration, 100 mM) and deglycosylated with PNGase F (New England Biolabs, Ipswich, USA), respectively following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Eluted glycopeptides were lyophilized and then deglycosylated by incubation with 50 µL of 1 unit per microliter of PGNase F (New England Biolabs, Ipswich, MA) in 50 mM Tris-HCl (pH=7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins (except from cells expressing eGFP and cytoplasmically tagged EGFR) were further treated with 250 U of PNGase F (NEB, Cat# P0704) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: For cloning/gene manipulation and DNA transfer into Methanothermobacter thermautotrophicus ΔH we utilized the Escherichia coli strains NEB stable (New England Biolabs, Frankfurt/Main, Germany) and S17-1 24 ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were dried in a speed vac before peptides were deglycosylated with Endo H or PNGase F according to manufacturer’s instructions (P07025 & P0710S, New England Biolabs Inc., Hitchin, United Kingdom).
-
bioRxiv - Molecular Biology 2023Quote: ... the pGL3 Basic vector and T/F LTR U3R PCR products were digested with KpnI and HindIII (New England Biolabs, Ipswich, MA, USA), individually as per manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR template containing the primer CRISPR-R and a CRISPR-F (containing the target sequence and a T7 promoter) were self-annealed and amplified using Phusion® (New England BioLabs, Ipswich, MA) polymerase with the following conditions ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 1.9 kb upstream of the transcription start site ATG of the At1g77960 gene was PCR amplified with RGO-promo-F and RGO-Promo-R primer pairs using Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Whitby, ON, Canada) with Arabidopsis genomic DNA as the template and was verified by DNA sequencing (Eurofins Genomics ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were further lysed with probe sonication and the lysate was denatured by adding 10 µL of denaturing buffer (NEB PNGase F kit, P0709) and heating at 100 °C for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... in DMEM/F12 + 10% FBS medium were incubated with 20 μg PNGase F (self-prepared for flow cytometry, NEB Cat. No. P0704 for confocal microscopy) for 5 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...