Labshake search
Citations for New England Biolabs :
551 - 600 of 642 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... marxianus strain CBS6556 (Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands) using Q5 High-Fidelity Polymerase (M4092L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... marxianus strain CBS6556 (Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands) using Q5 High-Fidelity Polymerase (M4092L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2021Quote: ... tuberculosis H37Rv (ATCC#25618) were procured through ATCC (USA). Escherichia coli (E. coli) strains DH5α and BL21 (DE3) were procured from NEB and were cultured in Luria–Bertani medium ...
-
bioRxiv - Cell Biology 2020Quote: ... the TAP coding sequence was PCR-amplified from chromosomal DNA from a strain expressing Heh2-TAP (SBCPL42, Dharmacon yeast resources) using Phusion High fidelity DNA polymerase (New England BioLabs) and cloned into the PacI and AscI sites of pFA6a-his3MX6 and pFA6a-TRP1.
-
bioRxiv - Cell Biology 2020Quote: ... or the same strain expressing OsTIR1 driven by the gra1-promoter with 50 μL of a PCR product using Q5 polymerase (NEB) with 500 bp homology arms flanking a tag (3xHA or AID-3xFLAG ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... melanogaster strain to be injected and inserted into plasmids containing fluorescent eye markers using NEBuilder Hi-Fi DNA assembly (NEB). See key resources table for primers sequences and donor plasmids.
-
bioRxiv - Microbiology 2023Quote: ... and complement strains (wos2Δ::WOS2) were constructed using biolistic transformation of constructs amplified using double-joint PCR or Gibson Assembly (NEB), as previously described (primers ...
-
bioRxiv - Microbiology 2023Quote: The RmlC expression constructs used in this study were constructed by PCR amplification of the rmlC alleles from strains MG1655 (rmlCWT) and BP27 (rmlCL122W) using the Q5 high-fidelity polymerase (NEB) and oligos listed in Table s1 and subsequent insertion into pBAD18-Chl via restriction digestion cloning.
-
bioRxiv - Molecular Biology 2023Quote: ... these antibiotic resistant cassettes were excised by transforming the strains with a plasmid expressing the Cre recombinase (pDR244, BGSCID: ECE274) purified from RecA+ Escherichia coli (NEB) cells with the GeneJET Plasmid Miniprep Kit (Thermo) ...
-
bioRxiv - Cell Biology 2023Quote: ... with s 3×HA sequence fused to the C-terminus and the ADH1 terminator sequence was amplified from genomic DNA of a yeast strain expressing Opi1-HA and subsequently cloned into the pRS416 vector using XhoI and SacII restriction enzymes (New England Biolabs). To overexpress INO1 and KCS1 ...
-
bioRxiv - Microbiology 2023Quote: ... the sequences of creS and their native promoter were amplified from strain CB15N and then assembled into the pCT133 or pCT155 backbone using Gibson assembly (New England Biolabs). For protein expression in E ...
-
bioRxiv - Microbiology 2023Quote: ... open reading frame was amplified from genomic DNA of the 237 Moraxella bovoculi strain by PCR and cloned into the pTN7C130 vector using HiFi assembly (NEB). The pTN7C130 vector is a mini-Tn7 vector that integrates into the attTn7 site of P ...
-
bioRxiv - Microbiology 2023Quote: Samples of a hundred micrograms of protein from the crude extracts of the strains of interest were incubated with Lambda phosphatase (λPP; 400 u per reaction; New England Biolabs) for 20 minutes at 30 °C [88] ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminally hexahistidine-tagged Sfr1 was co-expressed with Swi5 as an operon from a pET11b vector in an Escherichia coli BL21 DE3 strain (NEB) that had been pre-transformed with the pRARE2 plasmid (Novagen) ...
-
bioRxiv - Microbiology 2023Quote: ... difficile VPI10463 and UK1 strains and purified PCR products were directly cloned into the pMSR0 vector using NEBuilder HiFi DNA Assembly (New England Biolabs). The pMSR0-derived plasmids containing the allele exchange cassettes of the target genes were transformed into E ...
-
bioRxiv - Developmental Biology 2024Quote: ... bulk-extracted genomic DNA from these strains was used to set up PCR reactions for each primer set using Quick Load Taq 2X Master Mix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... See Table S1 for a full list of derived yeast strains. NEB Turbo competent Escherichia coli (E. coli) from New England Biolabs (NEB was used for all DNA cloning and plasmid propagation work.
-
bioRxiv - Bioengineering 2024Quote: ... The TSA1 promoter was amplified by PCR from genomic DNA obtained from the X-33 strain using Q5 polymerase (New England Biolabs) and primers TSA1_BstBI_Fw and TSA1-GFP_Rv_KpnI ...
-
bioRxiv - Biochemistry 2020Quote: ... Filters were then washed with 3 aliquots of 100 μL 50 mM ABC pH 8.0 before adding 1000U PNGase F (NEB #P0704) in 2M urea ...
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pSP64-eGFP-F-nos1-3’UTR (Weidinger et al., 2002) constructs were linearised with SacII and NotI restriction enzymes (NEB) respectively ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: Deglycosylation of S protein from the lysate of HEK293 cells transfected with pTwist-EF1a-nCoV-2019-S-2xStrep plasmid was performed as described previously [35] using PNGase F (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Biophysics 2020Quote: ... Point mutations (K66E and K166A) on F-BAR-EGFP were produced by the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). Identity of plasmids was confirmed by Sanger sequencing.
-
bioRxiv - Immunology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H218O (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Ten micrograms of purified RBD proteins were treated by 500 units of PNGase F (New England Biolabs, Ipswich, USA #P07045) according to manufacturer’s instruction ...
-
bioRxiv - Biophysics 2019Quote: ... This fragment was PCR-amplified with the oligonucleotides 89.F lambda 40002 XhoI and 90.R lambda 45263 ApaI using Lambda DNA (NEB) as a template ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... then ligating them into the pGGA-F GreenGate vectors or into the Golden Gate-ready pMiniT™2.0 (NEB #E1203S). Sequences containing BsaI cut sites (such as AtRDR1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was eluted at 100% Buffer F and protein fractions were pooled and combined with TEV and CIP (#M0525) from NEB and dialyzed overnight against Buffer E at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: Lysates of HEp-2/ι1hUNGs cells mock infected or infected with wild-type HSV-1(F) at an MOI of 10 for 24 h were treated with alkaline phosphatase (CIP) (New England BioLabs) as described previously48.
-
bioRxiv - Cell Biology 2023Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACAA-GAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by extending a common sgRNA(F+E) sequence with gene-specific crRNA sequence downstream of a T7 promoter by PCR with Phusion polymerase (NEB). PCR product was gel extracted and sgRNA was in vitro transcribed using the MegaShortScript™ T7 Transcription Kit (Invitrogen AM1354 ...
-
bioRxiv - Developmental Biology 2020Quote: Alg2 cDNA was amplified with RT-PCR from the cDNA of wt Oryzias latipes Cab strain stage 18 embryos with Q5® High-Fidelity DNA Polymerase (New England Biolabs) by using primers with BamHI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Successful generation of ΔpufX and ΔpufY strains was confirmed using PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, UK) and DNA sequencing (Eurofins).