Labshake search
Citations for New England Biolabs :
501 - 550 of 642 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Cleared cell lysates were incubated with PNGase F (500–1,000 U per 20 μl of lysats, NEB) for 30–45 min at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Flanking regions were amplified from the parental strains using either Q5 polymerase or OneTag polymerase (New England Biolabs). The OE PTS-HAL was generated in the Δvp1 and wild-type backgrounds by replacing the native PTS operon promoter with an amiA promoter and kan gene ...
-
bioRxiv - Microbiology 2022Quote: ... 30 μg of total RNAs from USA300 and ST80 strains were reversed transcribed with AMV reverse transcriptase (NEB) using 5’ radiolabelled primers (for hlgC (PEC1 ...
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2022Quote: Selenomethionine-derivatized FL-TgGAC was expressed in the methionine auxotroph T7 Express Crystal Escherichia coli strain (NEB #C3022) cultured in SelenoMethionine Medium Base plus Nutrient Mix (Molecular Dimensions MD12-501) ...
-
bioRxiv - Cell Biology 2023Quote: ... ERK7-BioID2-3xHA was created by transfecting the RHΔku80Δhxgprt strain (66) with 50 μL of a PCR product using Q5 polymerase (NEB) with 500 bp homology arms flanking a BioID2-3xHA tag together with 5 μg of a Cas9 plasmid that had been modified to express HXGPRT and also a gRNA targeting the C-terminus of ERK7 (37) ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Microbiology 2020Quote: ... or CatL-cleaved GPs were incubated with Protein N– glycosidase F (PNGaseF, 250U; New England Biolabs, Ipswich, MA) under reducing conditions for 16 h at 37℃to remove N–linked glycans ...
-
bioRxiv - Biochemistry 2022Quote: ... purified RML or ME7 fibrils were prepared as above and digested using recombinant PNGase F (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Biochemistry 2019Quote: ... streptavidin tips were incubated overnight in 50 mM ammonium bicarbonate containing 1,000 units PNGase F (New England Biolabs) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... N-glycans were released using N-glycanase PNGase F (1239U/ml, New England BioLabs, Inc. cat no. P0709L) and were fluorescently labelled with 2-aminobenzamide (2-AB ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Microbiology 2023Quote: ... E protein glycosylation status was determined by treating RVP lysates with PNGase F (Cat#P0704S, New England Biolabs) for 3 hours at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Biochemistry 2024Quote: Velaglucerase (VRPIV®, Takeda) and Imiglucerase (Cerezyme®, Sanofi) were deglycosylated using PNGase F enzyme (New England Biolabs). The deglycosylation reaction was performed according to the recommendation from the manufacturer ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was digested for 1 h at 37°C with PNGase F (New England Biolabs, P0704) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Methylation assays were performed using 100 ng of an unmethylated pUC19 plasmid purified from dam- /dcm- E.coli strain (C2925I, NEB) or a 1-kb fragment containing 14 CpG sites amplified from the Meis1 enhancer were used as DNA substrates for filter binding assays ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Microbiology 2021Quote: ... difficile strain 630 genomic DNA and cloned into the modified pDIA6103 using NEBuilder Hifi DNA Assembly (New England Biolabs). The resulting pDIA6103 derivative plasmid was transformed into the E ...
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Microbiology 2019Quote: ... Chromosomal deletion strains were constructed using the allele exchange vector pKAS32 digested with KpnI and SacI (NEB, High Fidelity). Luciferase reporters were constructed using the luciferase reporter vector pBBRlux digested with BamHI and SpeI (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transcription template for RNAI was produced by using p770 plasmid (from E. coli strain LK_2385) as template for PCR amplification using Q5 polymerase (NEB) and LK_3413 and LK_3414 primers to introduce a T7 class II promoter (Supplementary table 3) ...
-
bioRxiv - Genomics 2020Quote: ... Transformation efficiencies of all strains were monitored and normalised using a stock solution of pLITMUS28 (New England Biolabs, USA). In addition ...
-
bioRxiv - Biophysics 2022Quote: ... coli cells were used for all subcloning steps and for permanent storage of transfected strains (New England Biolabs (NEB) - C2987I) ...
-
bioRxiv - Biophysics 2022Quote: ... coli cells were used for all subcloning steps and for permanent storage of transfected strains (New England Biolabs (NEB) - C2987I) ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression of all SurA and SurA-OmpA proteins was carried out using chemically competent home-made stocks of E.coli strain BL21(DE3) originally sourced commercially (NEB). Both proteins were over-produced separately in 1 L of cultures as described previously [42] ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression of all soluble proteins used chemically competent home-made stocks of E.coli strain BL21(DE3) originally sourced commercially (NEB).
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was purified from single-humanized Hsα1 and quintuple-humanized Hsα1,α2,α3,α4,α7 strains using the Monarch Nucleic acid purification kit according to the manufacturer’s protocol (NEB). Spheroplasts were obtained before the genomic DNA extraction for a high-quality DNA prep ...
-
bioRxiv - Molecular Biology 2024Quote: The strains used in this work were T7 express and shuffle T7 express Escherichia coli cells (New England Biolabs). All strains were grown in Luria-Bertani (LB ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Microbiology 2020Quote: ... Protein samples were boiled in 1X Denaturing Buffer and incubated with PNGase F or Endo Hf (New England Biolabs) for 1-1.5 hr at 37°C following the manufacturer’s protocol ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Glycopeptides from the other replicate was then deglycosylated by incubation with 50 μL of 50 mM Tris-HCl (pH=7.5) with 1 unit per microliter of PGNase F (New England Biolabs) over night at 37 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Synthetic Biology 2022Quote: ... long overlapping primers tRNA-fMet-C1G_temp F and RNA-fMet-C1G-A_temp R (Extended Data Table 1) were PCR amplified using Q5 DNA polymerase (NEB). Products were gel purified and amplified using short primers tRNA-fMet-C1G_amp F and tRNA-fMet-C1G-A_amp R (Extended Data Table 1) ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting cDNA was PCR amplified using primers A1.MS-SDA-ADDobody-F and tonBtot_R (Table S4) using Q5 DNA polymerase (New England Biolabs) and reactions conditions according to the manufacturer’s recommendations (initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Immunology 2023Quote: ... Glycan removal was performed on 20 µg or 25 µg total protein using PNGase F (#P0704; New England Biolabs), Endo H (#P0702 ...
-
bioRxiv - Neuroscience 2024Quote: Deglycosylation of total brain homogenates was performed according to the PNGase F kit instruction manual (#P0704S, New England Biolabs). 40µg of protein were digested with 1,000 U of PNGase F enzyme.
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2021Quote: ... The D614G S-protein was generated by introducing the mutation into the Wuhan reference strain via Q5 Site-directed mutagenesis (NEB). Other individual mutations were subsequently introduced into the D614G S by the same process ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting amplicons from each replicate/strain were cleaned up using the Monarch PCR & DNA Cleanup kit (New England Biolabs). Next ...