Labshake search
Citations for New England Biolabs :
601 - 650 of 684 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... open reading frame was amplified from genomic DNA of the 237 Moraxella bovoculi strain by PCR and cloned into the pTN7C130 vector using HiFi assembly (NEB). The pTN7C130 vector is a mini-Tn7 vector that integrates into the attTn7 site of P ...
-
bioRxiv - Microbiology 2023Quote: Samples of a hundred micrograms of protein from the crude extracts of the strains of interest were incubated with Lambda phosphatase (λPP; 400 u per reaction; New England Biolabs) for 20 minutes at 30 °C [88] ...
-
bioRxiv - Microbiology 2023Quote: ... the sequences of creS and their native promoter were amplified from strain CB15N and then assembled into the pCT133 or pCT155 backbone using Gibson assembly (New England Biolabs). For protein expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... with s 3×HA sequence fused to the C-terminus and the ADH1 terminator sequence was amplified from genomic DNA of a yeast strain expressing Opi1-HA and subsequently cloned into the pRS416 vector using XhoI and SacII restriction enzymes (New England Biolabs). To overexpress INO1 and KCS1 ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminally hexahistidine-tagged Sfr1 was co-expressed with Swi5 as an operon from a pET11b vector in an Escherichia coli BL21 DE3 strain (NEB) that had been pre-transformed with the pRARE2 plasmid (Novagen) ...
-
bioRxiv - Microbiology 2023Quote: ... difficile VPI10463 and UK1 strains and purified PCR products were directly cloned into the pMSR0 vector using NEBuilder HiFi DNA Assembly (New England Biolabs). The pMSR0-derived plasmids containing the allele exchange cassettes of the target genes were transformed into E ...
-
bioRxiv - Genomics 2024Quote: ... the cloned vector was cleaned using standard ethanol precipitation (Sambrook and Russell 2001) and electroporated into 50ul of NEB stable E.coli strain (NEB; C3040H) using 1ul of cloning material (Applied volts-2200V ...
-
bioRxiv - Plant Biology 2024Quote: ... MBP-RVE4 and MBP-RVE8 proteins were expressed in Escherichia coli BL21 strain according to the manufacturer’s instructions using the pMAL Protein Fusion and Purification System (New England Biolabs; #E8200) and purified using MBPtrap HP column (Cytiva ...
-
bioRxiv - Biochemistry 2020Quote: ... Filters were then washed with 3 aliquots of 100 μL 50 mM ABC pH 8.0 before adding 1000U PNGase F (NEB #P0704) in 2M urea ...
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pSP64-eGFP-F-nos1-3’UTR (Weidinger et al., 2002) constructs were linearised with SacII and NotI restriction enzymes (NEB) respectively ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: Deglycosylation of S protein from the lysate of HEK293 cells transfected with pTwist-EF1a-nCoV-2019-S-2xStrep plasmid was performed as described previously [35] using PNGase F (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Biophysics 2020Quote: ... Point mutations (K66E and K166A) on F-BAR-EGFP were produced by the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). Identity of plasmids was confirmed by Sanger sequencing.
-
bioRxiv - Immunology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H218O (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Ten micrograms of purified RBD proteins were treated by 500 units of PNGase F (New England Biolabs, Ipswich, USA #P07045) according to manufacturer’s instruction ...
-
bioRxiv - Biophysics 2019Quote: ... This fragment was PCR-amplified with the oligonucleotides 89.F lambda 40002 XhoI and 90.R lambda 45263 ApaI using Lambda DNA (NEB) as a template ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by extending a common sgRNA(F+E) sequence with gene-specific crRNA sequence downstream of a T7 promoter by PCR with Phusion polymerase (NEB). PCR product was gel extracted and sgRNA was in vitro transcribed using the MegaShortScript™ T7 Transcription Kit (Invitrogen AM1354 ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Plant Biology 2022Quote: ... then ligating them into the pGGA-F GreenGate vectors or into the Golden Gate-ready pMiniT™2.0 (NEB #E1203S). Sequences containing BsaI cut sites (such as AtRDR1 ...
-
bioRxiv - Microbiology 2023Quote: Lysates of HEp-2/ι1hUNGs cells mock infected or infected with wild-type HSV-1(F) at an MOI of 10 for 24 h were treated with alkaline phosphatase (CIP) (New England BioLabs) as described previously48.
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Type I-F Cascade was co-expressed with 6xHis-MBP-TEV-TniQ and a type III-B crRNA in NiCo21 cells (NEB). Cells were then induced with 0.5 mM isopropyl at 18 °C for another 18–20 hours before harvesting ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was eluted at 100% Buffer F and protein fractions were pooled and combined with TEV and CIP (#M0525) from NEB and dialyzed overnight against Buffer E at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Cell Biology 2024Quote: ... StrepII-EPLINα WT plasmid was created by inserting the EPLINα PCR product (created with EPLINα Strep F/R primers) into pcDNA3 StrepII MCS vector cleaved with EcoRI/AgeI using NEBuilder HiFi DNA Assembly (NEB). The deletion mutants (ΔNHX ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Cell Biology 2024Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTC-CATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACA-AGAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Developmental Biology 2020Quote: Alg2 cDNA was amplified with RT-PCR from the cDNA of wt Oryzias latipes Cab strain stage 18 embryos with Q5® High-Fidelity DNA Polymerase (New England Biolabs) by using primers with BamHI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Successful generation of ΔpufX and ΔpufY strains was confirmed using PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, UK) and DNA sequencing (Eurofins).
-
bioRxiv - Microbiology 2021Quote: ... Between 1-2kb of flanking regions upstream and downstream of the region of interest were amplified from parental strain using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Microbiology 2022Quote: ... To gain fusion strain characteristic banding patterns the restriction digestion of genomic DNA was performed with PacI (New England Biolabs, USA). For PFGE analysis ...
-
bioRxiv - Microbiology 2019Quote: ... Between 1-2kb of flanking regions upstream and downstream of the regions of interest were amplified from parental strains using Q5 2x Master Mix (New England Biolabs, USA). The antibiotic resistance gene ermB was amplified from S ...
-
bioRxiv - Molecular Biology 2021Quote: ... BLS148 was created by P1 phage transduction of ΔlacIZYA::kmR from strain TB12 (P1 phage lysates were a gift from Thomas Bernhardt, Harvard Medical School) to SHuffle® Express (NEB) according to a protocol established by Robert T ...
-
bioRxiv - Microbiology 2022Quote: ... the corresponding ORFs were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR assays were performed with the strain-specific multiplex primers from (46) and Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Strep–PIF4 recombined proteins were expressed in the Escherichia coli BL21 (DE3) strain and then purified using amylose resin (NEB, E8021S). DNA probes of NHX1 and SAL1 were synthesized and labeled using the Biotin 3′ End DNA Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4.8 × 109 cells were harvested and total RNA from three biological replicates was extracted for each strain using the Monarch® Total RNA Miniprep (NEB) Kit ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...