Labshake search
Citations for Illumina :
8301 - 8350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA libraries were prepared with Illumina Truseq stranded mRNA kit (Illumina), which uses polyT beads to capture polyadenylated RNA sequences ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and prepared strand-specific libraries with the TruSeq strand-specific Total RNA kit (Illumina Inc.), which was sequenced on the NextSeq 500 system to obtain 50 million 100bp paired end reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Barcoded reads were de-multiplexed using the CASAVA pipeline 1.8 (Illumina, Inc.). The obtained raw sequence reads (0.5–4 million per individual ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... high-throughput genomic DNA library preparation and whole genome sequencing (Illumina HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequencing libraries were created using the TruSeq (Illumina) protocol with 350 bp insert size ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and sequenced on a NovaSeq 6000 (Illumina) using a 2×150 bp setup and targeting 50x coverage ...
-
bioRxiv - Genetics 2023Quote: ... Five percent PhiX DNA (Illumina Inc.) was added to each library pool during cluster amplification to boost diversity ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Genomics 2023Quote: ... using NovaSeq Reagent Kits (Illumina) and the SBS (Sequence By Synthesis ...
-
bioRxiv - Genetics 2023Quote: ... we demultiplexed raw sequencing reads using the bcl2fastq program (Illumina) and filtered for sequencing reads that mapped unambiguously to either the wild-type or edited PPIF promoter sequences by running CRISPResso2 in HDR mode97 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Pooled libraries were sequenced using paired-end 150 bp reads on different lanes of an Illumina NovaSeq 6000 (Illumina, San Diego, USA) at the Genome Quebec Innovation Center (Montreal ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The libraries for Illumina sequencing were constructed according to standard protocols using the Illumina DNA prep kit and IDT 10 bp UDI indices (Illumina, San Diego, CA, USA) by the sequencing facility at SEQCENTER (PA ...
-
bioRxiv - Genomics 2023Quote: ... RNA libraries were prepared from 500 ng RNA samples using the TruSeq Stranded mRNA Kit (Illumina Inc., San Diego, CA, US) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Urine samples were then sequenced with (either the 2 x 150 bp or 2 x 75 bp configuration) to a mean depth of 30 M reads per sample on NextSeq 2000 (Illumina Inc); sequencing length did not impact gene detection efficiency (Supplementary Fig ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were sequenced using an Illumina HiSeq2500 equipment (Illumina) in paired-end (2×125 pb ...
-
bioRxiv - Genomics 2023Quote: ... Each replicate per condition was sequenced on a HiSeq 4000 (Illumina) in a different batch such that each sequencing batch contained one replicate from each condition.
-
bioRxiv - Genomics 2023Quote: ... RNA was extracted from similar pooled-samples (N = 3) using the ZYMO (Irvine, CA, USA) direct-zol miniprep kit (Cat. # R2050) and sequenced using NovaSeq (Illumina, San Diego, CA, USA) paired-end (150 bp ...
-
bioRxiv - Genomics 2023Quote: ... Samples were sequenced on a HiSeq2500 HighOutput (Illumina) with a 5% spike-in of PhiX ...
-
bioRxiv - Genomics 2023Quote: ... The short reads produced by Illumina technology were used to estimate genome size and correct errors in the assembled genome ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were sequenced (Illumina HiSeq 4000 H4K paired-end 150 cycle) followed by quality control (adaptor trimming ...
-
bioRxiv - Genomics 2023Quote: ... The nucleotide sequences of the resultant libraries were determined using HiSeq 1000 (Illumina) in paired-end ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Illumina UD 96 index kit (Illumina, San Diego, CA, USA) to add barcodes ...
-
bioRxiv - Genetics 2023Quote: ... The construction of the sequencing library was adapted from Illumina’s amplicon sequencing protocol #15044223 Rev ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Genetics 2023Quote: ... The denatured combined library was loaded into the MiSeq Reagent Kit v3 (600 cycle) (Illumina, MS-102-3003). The cluster density was ∼1100 K/mm2.
-
bioRxiv - Genetics 2023Quote: ... Poly-A selection and cDNA synthesis were performed using the TruSeq Stranded mRNA kit as outlined by the manufacturer (Illumina RS-122-2103). All steps were automated on the Perkin Elmer Sciclone NGSx Workstation ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... cDNA libraries were prepared with the TruSeq stranded mRNA library prep Kit (cat# RS-122-2101, Illumina, San Diego, CA, USA). The resulting libraries were sequenced on a HiSeq 4000 (Genomics & Cell Characterization Core Facility ...
-
bioRxiv - Genomics 2023Quote: ... Clustering and sequencing were performed on a NovaSeq6000 (Illumina,) using NovaSeq Reagent Kits (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Polyadenylated RNA was captured using oligo(dT) magnetic beads and libraries were synthesized using Stranded mRNA Prep Ligation (Illumina). RNAs were chemically fragmented and synthesis of the first strand of cDNA was made in the presence of actinomycin D ...
-
bioRxiv - Genetics 2023Quote: ... we demultiplexed raw sequencing reads using the bcl2fastq program (Illumina) and used CRISPResso297 to align reads with a minimum average quality score of 20 (phred 33 ...
-
bioRxiv - Genomics 2023Quote: ... the pDNA was sequenced by Illumina HiSeq2500 High Output.
-
bioRxiv - Genetics 2023Quote: ... 30 million paired-end 150bp reads were obtained for each ChIP-ISO and input sample using a NextSeq 2000 (Illumina) instrument ...
-
bioRxiv - Genetics 2023Quote: ... Sequencing library was constructed by the Illumina Stranded mRNA Prep kit (Illumina 20040532). 30 million paired-end 50bp reads were obtained for each RNA-seq sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Genetics 2023Quote: ... Samples were sequenced using 75 bp paired-end sequencing (reverse stranded) on a NovaSeq 6000 system (S4 flow cell, Xp workflow; Illumina).
-
bioRxiv - Genetics 2023Quote: ... NEXTflex™ ChIP-Seq Barcodes kit (Illumina compatible) (BIOO Scientific Corp. ...
-
bioRxiv - Genetics 2023Quote: ... in a NextSeq 500 platform (Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2023Quote: ... libraries were sequenced as 150-bp single-end reads using the High Output v2 Kit (Illumina, San Diego, CA, USA) in a NextSeq 500 platform (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... The mRNA-sequencing was performed by Novogene (Cambridge, UK) using the NovaSeq 6000 platform (Illumina, United States), generating paired-end 150 bp reads ...
-
bioRxiv - Genetics 2023Quote: ... The scaffolds were further polished and corrected using five rounds of Pilon (Walker et al. 2014) using both raw reads from Nanopore/PacBio sequencing and short paired-end reads from Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2023Quote: ... idat files were converted to gtc format based on human genome build GRCh38.p13 using the iaap cli (v1.1.0) followed by conversion to VCF using gtc_to_vcf.py (v1.2.1)(https://github.com/Illumina/GTCtoVCF).
-
bioRxiv - Genetics 2023Quote: ... five forward and five reverse primers contain Nextera transposase adapter sequences (Illumina Document#1000000002694) “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG” (read 1 ...
-
bioRxiv - Genetics 2023Quote: ... B-allele frequency (BAF) and log-likelihood (LRR) data were generated using GenomeStudio v2.0.5 (Illumina Inc.) with a custom cluster file created according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequenced by Illumina Hiseq 1500 to obtain single end 50 nt reads.
-
bioRxiv - Developmental Biology 2023Quote: ... Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...
-
bioRxiv - Developmental Biology 2023Quote: ... and sequenced by Illumina NextSeq 500 (Illumina) using Nextseq 500/550 High Output v2.5 Kit (Illumina ...