Labshake search
Citations for Illumina :
8151 - 8200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and KAPA Library Quant (Illumina) DNA Standards 1-6 (KAPA Biosystems KK4903) ...
-
bioRxiv - Neuroscience 2023Quote: ... FASTQ files were generated from the raw sequencing runs and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina). Adaptors were trimmed from the 3’-end of the reads ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were pooled and then sequenced by NovaSeq 6000 (Illumina). The BDTM Rhapsody docker setup (BD ...
-
bioRxiv - Neuroscience 2023Quote: ... Paired-end 150- base pair reads were sequenced with the NovaSeq 6000 platform (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... and were subject to 100 nt paired-end sequencing (Illumina NovaSeq S1 (XP)) to generate 22∼30 million mapped reads per sample at the UCLA Neuroscience Genomics Core (UNGC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TDE1 Nextera Tn5 Transposase (Illumina, #FC-121-1030) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: RNA library preparation was performed using TruSeq Stranded mRNA library prep kit (Illumina, cat. no 20020594) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Three pM libraries were loaded onto NextSeq 500 (Illumina, San Diego, CA) for sequencing using the NextSeq 500/550 High Output Kit v2.5 (150 Cycles) ...
-
bioRxiv - Neuroscience 2023Quote: ... We then randomly selected 2–3 scrambled-injected and 5–6 F0 knockout larvae for sequencing of the targeted loci (see Preparation of samples for Illumina MiSeq).
-
bioRxiv - Neuroscience 2023Quote: ... Eighteen pM libraries were clustered in a high-output flow cell using HiSeq Cluster Kit v4 on a cBot (Illumina). After cluster generation ...
-
bioRxiv - Neuroscience 2023Quote: ... Then we multiplexed the samples and performed sequencing using the NovaSeq S1 100nt Flowcell v1.5 (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Synthesized libraries were sequenced on a Nextseq 500 System (Illumina) with paired-end 75 bp reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end (PE150) sequences were generated using a NovaSeq 6000 apparatus (Illumina) by Novogen (Cambridge ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by sequencing (Illumina HiSeq 3000).
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end strand specific libraries were constructed using the TruSeq stranded mRNA (polyA) Librabry Prep Kit (Illumina) and were subject to 100 nt paired-end sequencing (Illumina NovaSeq S1 (XP) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysed cells were then treated with 2xTD reaction buffer (Illumina, #FC-121-1030) and TDE1 Nextera Tn5 Transposase (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicon next generation sequencing was performed by BMFZ-GTL Düsseldorf (GE) with a MiSeq system (Illumina, USA).
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Physiology 2023Quote: ... followed by onboard clonal clustering of the patterned flow cell using the NovaSeq 6000 S1 Reagent Kit v1.5 (200 cycle) (Illumina 20028318). A 2x101 cycle sequencing profile with dual index reads is completed using the following sequence profile ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified fragments were sequenced using a 150-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1002) on an Illumina MiniSeq ...
-
bioRxiv - Molecular Biology 2023Quote: ... Resultant libraries were sequenced on a HiSeq2500 platform (Illumina, 100 bases, single-end). All the oligos used in the icSHAPE library preparation are noted in Supplementary Table 6a.
-
bioRxiv - Microbiology 2023Quote: ... The amplified barcodes were sequenced using a 75-cycle MiniSeq High Output Reagent Kit (Illumina, FC-420-1001) on an Illumina MiniSeq at Michigan State University ...
-
bioRxiv - Cell Biology 2023Quote: ... and sequenced on the NextSeq500 (Illumina) as 75 bp single-end reads ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA library was then fragmented and indexed using the Nextera DNA Library Preparation kit (Illumina, San Diego, CA, USA). The library quality was checked on a BioAnalyzer high-sensitivity chip and concentration was quantified by Qubit assays (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10 nM sequencing pool (120 µl in Tris-HCl, pH 8.5) was generated for sequencing on the NovaSeq6000 Sequencing platform (Illumina; service provided by CeGaT GmbH ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was ribo-depleted using a magnetic RiboZero kit (Illumina, MRZH11124), and RNA quality was checked by Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: Sequencing was performed on an Illumina HiSeq 4000 (Illumina, San Diego, CA, USA) using the Drop-seq custom read 1B primer (GCC TGT CCG CGG AAG CAG TGG TAT CAA CGC AGA GTA C ...
-
bioRxiv - Physiology 2023Quote: ... Samples were sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA) using 2×300 bp paired-end sequencing at the RI-INBRE Molecular Informatics Core (Kingston ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and uniquely indexed libraries using unique dual indexes (Illumina). Libraries were pooled in equal molar concentration and sequenced on one lane each of 150 bp paired-end NovaSeq S1 and NovaSeq S4 at the Vincent J ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We generated Illumina cDNA libraries from 1 μg of purified RNA using KAPA Stranded mRNA-Seq Kit (Illumina), and uniquely indexed libraries using unique dual indexes (Illumina) ...
-
bioRxiv - Physiology 2023Quote: ... Samples were then sequenced on an Illumina MiSeq (Illumina, San Diego, CA) for 2×300 bp paired-end sequencing at the RI-INBRE Molecular Informatics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... (iii) experimental design different from case-control and (iv) methylation profiling platform other than Infinium HumanMethylation450 BeadChip from Illumina. The study platform was chosen for its high resolution - around 450,000 methylation sites - and its wide acceptance in the field [19].
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were sequenced at Microbial Genome Sequencing Center (Pittsburgh, PA) on an Illumina NextSeq 2000 (Illumina). RNA libraries for RNA-seq were prepared using Illumina Stranded RNA library preparation with RiboZero Plus rRNA depletion.
-
bioRxiv - Microbiology 2023Quote: ... Illumina libraries were prepared using a Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA) and sequenced on the NextSeq550 platform ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... because Ion Torrent sequencing tends to make homopolymer errors and produces higher numbers of indels (relative to Illumina sequencing), we applied a homopolymer gap penalty of -1 and applied a more restrictive threshold for the number of insertions in one sequence relative to another (BAND_SIZE = 32) ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing was performed on an HiSeq 4000 (Illumina), with a sequencing depth of 1 line per sample.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Proteles cristatus genomes have been previously reconstructed using long (ONT) and short (Illumina) reads assembled with MaSuRCA v3.2.9 (88 ...
-
bioRxiv - Immunology 2023Quote: ... Ligation with Ribo-Zero Plus kit (Illumina) and IDT for Illumina RNA UD Indexes Set A ...
-
bioRxiv - Immunology 2023Quote: ... Ligation (Illumina). Purified libraries were qualified on an Agilent Technologies 2200 TapeStation using a D1000 ScreenTape assay ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA samples (200-500 ng) were hybridized with Ribo-Zero Plus (Illumina) to deplete cytoplasmic and mitochondrial and ribosomal RNA from samples ...
-
bioRxiv - Developmental Biology 2023Quote: ... Demultiplexing was performed with Illumina Bcl2fastq2 program (version 2.19.1.403; Illumina Inc.).
-
bioRxiv - Physiology 2023Quote: ... and KAPA Library Quant (Illumina) DNA Standards 1-6 (KAPA Biosystems KK4903) ...
-
bioRxiv - Pathology 2023Quote: ... The library was sequenced using Illumina technology (Illumina Genome Analyzer IIx System). Library generation and sequencing were performed by the CNIC Genomics Unit under the supervision of Dr ...
-
Juxtacrine DLL4-NOTCH1 signaling between astrocytes drives neuroinflammation via the IL-6-STAT3 axisbioRxiv - Neuroscience 2023Quote: ... Pooled library preparations were sequenced on NextSeq® 500 whole genome sequencing (Illumina®), corresponding to 2×30million reads per sample after demultiplexing ...
-
bioRxiv - Neuroscience 2023Quote: Reads were demultiplexed with CASAVA (Illumina) and read quality was assessed using FastQC (https://www.bioinformatics.babraham.ac.uk/ ...
-
bioRxiv - Neuroscience 2023Quote: ... Integrity of cDNA libraries were assessed with a High Sensitivity DNA Kit on a Bioanalyzer 2100 before samples were sent for 2×150bp paired-end sequencing on an Illumina NovaSeq 6000 (Illumina) at the Interdisciplinary Center for Biotechnology Research (ICBR ...
-
bioRxiv - Neuroscience 2023Quote: ... the tagmented DNA was amplified using Illumina primers (NEBNext® Multiplex Oligos for Illumina, NEB #7335S) with the following cycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... Pooled libraries were sequenced on the Illumina NextSeq 500 platform using the High Output Kit v2.5 for 150 Cycles (Illumina, 20024907).
-
bioRxiv - Neuroscience 2023Quote: ... and Illumina sequenced (150-nt pair-end sequencing; Illumina NovaSeq 6000).