Labshake search
Citations for Illumina :
701 - 750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Molecular Biology 2024Quote: ... Illumina indexes were added by amplifying 1 ng DNA to a 50 μl PCR reaction using Kapa HS enzyme and unique dual indexing primers (Illumina) for 11 cycles (Denaturation 95°C 3min ...
-
bioRxiv - Molecular Biology 2024Quote: Paired‐end libraries were prepared using the DNA sample kit (#1003382, Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and diluted to 12 pM for sequencing on the NovaSeq 6000 system (SP, PE50bp and PE75bp, Illumina) according to the manufacturers guidelines (Figure 1C).
-
bioRxiv - Molecular Biology 2024Quote: ... The libraries were adjusted to 10 pM spiked in with 15% PhiX Control v3 Library and sequenced on the NextSeq550 and HiSeq2500 (Illumina) platform (R1 – 54 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... Sequencing was performed by NovaSeq (Illumina) at 2x150 reads base pairs (bps ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was done on a PE150 (Illumina), and raw reads were aligned against the S ...
-
bioRxiv - Microbiology 2024Quote: ... Library preparation was performed using Nextera DNA Flex Library Prep Kit (Illumina) and sequencing was done on a MiSeq Illumina platform (short-read sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... pooled and sequenced on MiSeq (Illumina, 2 x 250 bp) using the MiSeq reagent kit v2 (500 cycles).
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Neuroscience 2024Quote: ... High-throughput RNA sequencing (RNA-seq) was performed by Illumina NovaSeq 6000 at Novogene (CA ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were then pooled at equimolar concentration and sequenced in 150PE mode on an Illumina NextSeq500 (Illumina). On average 42 million fragments were produced for each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... The libraries were sequenced on a shared S4 flowcell on a NovaSeq6000 (Illumina) instrument to a target depth of 10,000 reads per nucleus.
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were pooled and sequenced together on a NovaSeq 6000 with S4 flow cell (Illumina, San Diego, CA) using paired-end ...
-
bioRxiv - Neuroscience 2024Quote: ... This library pool was sequenced on a shared 25B flowcell on a Novaseq X (Illumina) instrument to a target depth of 10,000 reads per nucleus.
-
bioRxiv - Neuroscience 2024Quote: ... and “PolyA” library with TruSeq Stranded mRNA Library Prep Kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and subsequently sequenced by Illumina NovaSeq 6000 or Illumina NextSeq 500/550 (LabGenomics ...
-
bioRxiv - Neuroscience 2024Quote: ... RNAseq libraries were prepared from 2500 ng total RNA using the TruSeq RNA Library Preparation Kit v2 (Illumina, San Diego, CA, USA) after poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the TruSeq stranded mRNA library preparation kit (Illumina Inc. San Diego, CA), including polyA selection according to the manufacturer’s protocol (Illumina Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were sequenced on a NextSeq 2000 machine using NextSeq 2000 P3 reagents (Illumina, San Diego, CA).
-
bioRxiv - Neuroscience 2024Quote: ... diluted to 270 pM and sequenced as paired end 100bp reads on an Illumina NovaSeq 6000 (Illumina). The sequencing aimed to achieve a depth of approximately >15 million clusters per sample.
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were pooled and sequenced on the NovaSeq 6000 platform (Illumina) to generate 50 million paired-end 100bp reads for each sample ...
-
bioRxiv - Neuroscience 2024Quote: ... and subjected to tagmentation with the Illumina Nextera XT kit (Illumina, FC-131-1096). Each sample was PCR amplified with a unique set of Nextera indices ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: ... Sequencing was performed on a NextSeq 2000 sequencer with P2-100 reagents (Illumina). Libraries were diluted and pooled according to the recommendation of the sequencing kit.
-
bioRxiv - Microbiology 2024Quote: ... This is based on the index-hopping rate of about 0.1-2% as listed by Illumina (https://sapac.illumina.com/techniques/sequencing/ngs-library-prep/multiplexing/index-hopping.html).
-
bioRxiv - Microbiology 2024Quote: ... samples were indexed with the XT Index Kit (Nextera®) and sequenced using the MiSeq platform (Illumina). Base calling and quality assessment was performed with Real Time Analysis version 1.18.54.0 ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared as described by the Earth Microbiome Project [53] and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, CA).
-
bioRxiv - Neuroscience 2024Quote: ... One ng of cDNA was used as input for preparation of sequencing libraries using the Nextera XT DNA Sequencing kit (Illumina). Libraries were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... the Truseq Stranded mRNA kit (Illumina) was used with an input of 100-1000 nanograms of total RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Sequencing was performed on a NovaSeq 6000 (Illumina Inc., San Diego, USA) at the Australian Genome Research Facility (Melbourne ...
-
bioRxiv - Evolutionary Biology 2024Quote: We demultiplexed reads of both DNA and cDNA sequencing and trimmed adapters with bcl2fastq v2.20 (Illumina, 2017) allowing for up to two mismatches in the barcode and discarding trimmed reads shorter than 20 base pairs (bp) ...
-
bioRxiv - Molecular Biology 2024Quote: Using the bcl2fastq v2.18 program (Illumina Inc.), the raw MiSeq data were first converted to FASTQ files ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... sequencing libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina Inc.). The library preparation was performed according to the manufacturers’ instructions (guide#15036187).
-
bioRxiv - Evolutionary Biology 2024Quote: ... We used a MiSeq system (Illumina Inc. San Diego, CA, USA) to perform 250-bp paired end sequencing on the prepared libraries (Illumina MiSeq Kit V2 500 cycles).
-
bioRxiv - Evolutionary Biology 2024Quote: ... to perform 250-bp paired end sequencing on the prepared libraries (Illumina MiSeq Kit V2 500 cycles).
-
bioRxiv - Evolutionary Biology 2024Quote: Sequencing was performed with MiSeq (Illumina Inc.) paired-end 300bp read length and v3 sequencing chemistry ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing was performed on the NextSeq500 instrument (Illumina) using v2 chemistry ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified iCLIP2 libraries were sequenced on a NextSeq 500 System (Illumina) using a NextSeq® 500/550 High Output Kit v2 as 92-nt single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: 50,000 HUVEC were used for ATAC library preparation using lllumina Tagment DNA Enzyme and Buffer Kit (Illumina). The cell pellet was resuspended in 50 µl of the lysis/transposition reaction mix (25 µl TD- Buffer ...
-
bioRxiv - Genomics 2024Quote: ... The QC check for the prepared libraries was done on an Agilent Tapestation (Santa Clara, California, USA) and libraries were sequenced on the Illumina MiSeq platform (Illumina, San Diego ...
-
bioRxiv - Molecular Biology 2024Quote: ... on an Illumina MiSeq sequencer (Illumina Inc.) at IDEA Consultants ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2014) was used to create a new structural annotation integrating data from de novo transcriptomes (based on Illumina and PacBio reads obtained in this study) ...
-
bioRxiv - Genomics 2024Quote: Library preparation was performed using the TruSeq DNA Nano Kit (Illumina, USA), and sequencing was conducted using an Illumina MiSeq instrument and a paired end read format of 2x150bp for 300 cycles at the Philippine Genome Center ...
-
bioRxiv - Genomics 2024Quote: ... The 151-bp 2D paired-end sequencing was performed using a NovaSeq 6000 sequencing system (Illumina) with an S4 PE 2×150 flow cell in XP mode.
-
bioRxiv - Cancer Biology 2024Quote: ... Poly-A enriched RNA was used to prepare RNA-seq libraries using the NEBNext Ultra RNA Library Prep Kit from Illumina following the manufacturer’s protocol (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... Metatranscriptome sequencing was done (2x 50 bp, 50 mio reads/sample) with Illumina HiSeq (Illumina, USA) without prior rRNA removal (DNASense ...
-
bioRxiv - Cancer Biology 2024Quote: ... is used to align long isoform reads to the reference genome hg38 (instead of the STAR aligner used with shorter Illumina RAN-seq), followed by our implementation of the GATK best practices for variant calling using RNA-seq (https://gatk.broadinstitute.org/hc/en-us/articles/360035531192-RNAseq-short-variant-discovery-SNPs-Indels) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were sequenced on NovaSeq 6000 (Illumina). Raw BCL-files were demultiplexed using bcl2fastq (version 2.20.0.422 from Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Raw BCL-files were demultiplexed using bcl2fastq (version 2.20.0.422 from Illumina) and read quality control performed using fastqc (version 0.11.9) ...
-
bioRxiv - Cell Biology 2024Quote: ... The libraries were sequenced using a NextSeq 500/550 High Output v2 Kit (Illumina) with custom primers ...