Labshake search
Citations for Illumina :
751 - 800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 100 ng of DNase-treated total RNA was used for library preparation with the Illumina Stranded Total RNA Prep Ligation with Ribo- Zero Plus kit (Illumina). The libraries were evaluated using an Agilent High-Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... or HiSeq X (Illumina). The adapter sequence was trimmed using cutadapt-1.1255 ...
-
bioRxiv - Cell Biology 2024Quote: ... NextSeq 1000/2000 P2 Reagents (100 cycles) v3 (Illumina), or HiSeq X (Illumina) ...
-
bioRxiv - Cell Biology 2024Quote: ... and then sequenced using either a NextSeq 500/550 High Output v2 Kit (Illumina), NextSeq 1000/2000 P2 Reagents (100 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were equimolarly pooled and 1.8 pM of the pool with 15% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp single-read sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2024Quote: ... and paired-end sequencing (150 bp) was performed on the NovaSeq 6000 platform (Illumina). To mitigate index hopping and minimize false virus–host assignments ...
-
bioRxiv - Microbiology 2024Quote: ... including polyA selection according to the manufacturer’s protocol (Illumina Inc. San Diego, CA). The mRNA libraries were sequenced on one NovaSeq SP flowcell with a 2×150 setup using the Illumina NovaSeq6000 system at the SNP&SEQ Technology Platform ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the Nextera XT library preparation kit (Illumina, Inc.). After indexing using a dual barcoding system according to the manufacturer’s protocol and then normalizing to a concentration of 4nM ...
-
bioRxiv - Microbiology 2024Quote: ... clean reads (i.e. Illumina) were input into NextPolish v.1.4.1 [57] to polish the complete genome ...
-
bioRxiv - Microbiology 2024Quote: ... Ribo-Zero Plus Kit (Illumina) was employed for host ribosomal RNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Microbiology 2024Quote: ... Demultiplexed and adaptor-trimmed reads generated by Illumina analytical tools were used for further processing.
-
bioRxiv - Microbiology 2024Quote: ... All libraries were prepared using the TruSeq Total RNA Library Preparation Protocol (Illumina). Ribo-Zero Plus Kit (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... The library pool was sequenced on a NovaSeq (Illumina) using an S2 v1.5 200bp kit with the cycle configuration 85 bp Read 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was eluted and processed as described in the SPLiT-seq protocol using the Nextera XT kit (Illumina #FC-131-1024) to generate the final RNA derived cDNA SPLiT-seq libraries [9] ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed in 2 x 250 bp paired-end format (Illumina, San Diego, CA). A total of 168 samples were sequenced on two separate sequencing runs at a similar read depth ...
-
bioRxiv - Microbiology 2024Quote: ... with Illumina TruSeq adapters (Illumina, San Diego, CA) and a target insert size of 350 bp ...
-
bioRxiv - Microbiology 2024Quote: ... double indexed libraries (Nextera XT indices) were prepared and sequenced on a MiSeq platform (Illumina) using a v3 chip as single 151 cycle reads ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed for 32 total samples in MiSeq v2 250 bp paired-end format (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2024Quote: ... on the NovaSeq6000 sequencer (Illumina). Raw intensity files from the sequencing run were demultiplexed and base called using CellRanger (10x Genomics ...
-
bioRxiv - Cancer Biology 2024Quote: ... were checked using the Agilent-2100 Bioanalyzer System and subjected to library preparation utilizing the TruSeq stranded total RNA Gold library preparation kit with RiboZero Gold treatment and unique dual indexes according to the manufacturer’s instructions (Illumina Inc., San Diego, CA, USA). The paired-end reads of 150 bp were generated in an S4 flowcell with v1.5 sequencing chemistry on a NovaSeq-6 000 platform (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2024Quote: Probe-level M-values were transformed to gene-level M-values by computing the median M-values of all probes linked with a gene as defined by the UCSC RefGene annotation (Illumina Human Methylation EPIC annotation 1.0 B5) ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end 150-bp sequencing was performed using the NovaSeq6000 system (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... Paired-end 150-bp sequencing was performed using the NovaSeq6000 system (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... and sequenced with a MiSeq instrument using MiSeq reagent kit V2 (Illumina). 150 bp paired-end reads were assembled with SPAdes (v3.15.557 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5µl of ATM (Illumina XT DNA sample preparation kit ...
-
bioRxiv - Microbiology 2024Quote: ... gDNA samples were converted to Illumina sequencing libraries using Illumina’s DNA Prep Sample Preparation Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... Shotgun metagenome sequencing libraries were created with the Nextera dual-indexed XT library prep kit (Illumina) and were sequenced on a single NovaSeq S4 lane with 2×150 base read lengths.
-
bioRxiv - Cancer Biology 2024Quote: ... The quality of the pooled-CRISPR-sgRNA library was verified by Illumina sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... High-throughput sequencing was performed on the NextSeq 500 Sequencing System (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... DNA libraries were prepared using Nextera DNA Flex Library prep kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Equimolar quantities of each indexed library were pooled for multiplex sequencing on the HiSeq 2500 (Illumina Inc.) platform ...
-
bioRxiv - Microbiology 2024Quote: ... according to Illumina’s official protocol (Illumina, 2013). A first PCR reaction was performed with KAPA HiFi 2X Mastermix (KAPA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and loaded onto the NextSeq 500 System (Illumina), with 75 cycles and single-read sequencing conditions.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were sequenced on an Illumina NextSeq 500 Sequencing System with NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Illumina, cat# 20024906). We loaded 1.8 pM of the library with 5% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... and run using a NextSeq 500/550 High Output Kit v2.5 with 75 cycles (Illumina, 20024906).
-
bioRxiv - Neuroscience 2024Quote: ... Illumina TruSeq libraries were prepared using kit and protocols from Illumina. High-throughput sequencing was performed on a HiSeq 2000.
-
bioRxiv - Neuroscience 2024Quote: ... to determine library quality and more in depth using NovaSeq6000 (Illumina). The targeted saturation for each sample was around 60% ...
-
bioRxiv - Neuroscience 2024Quote: ... 10x libraries were sequenced twice: shallow on NextSeq500 (Illumina) to determine library quality and more in depth using NovaSeq6000 (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... The generated scRNA-seq libraries were subjected to sequencing on a NovaSeq6000 system (100 cycles) (Illumina).
-
bioRxiv - Immunology 2024Quote: ... fragmented and hybridized using the TrueSeq Stranded mRNA kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a HiSeq4000 sequencer (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... 48 libraries were combined and sequenced on the NextSeq 500 machine (Illumina) using the High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Transcriptome was assessed using TrueSeq Stranded mRNA (Illumina) kit for library preparation ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by sequencing on Nextseq500 instrument using NextSeq HIGH 150 cycles (Illumina) reagents on high output flow cell in paired end mode ...
-
bioRxiv - Molecular Biology 2024Quote: ... Debarcoding was performed using Basespace (Illumina) platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pooled libraries were sequenced using Illumina short-read technology based on PE150 on the NovaSeq6000 (Illumina). After sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on a NovaSeq 6000 (Illumina, San Diego, CA, USA) at the Oklahoma Medical Research Foundation (OMRF ...
-
bioRxiv - Molecular Biology 2024Quote: ... mexicana (using an ONT-Illumina sequencing optimised MHOMGT2001U1103 genome annotation from Beneke et al ...