Labshake search
Citations for Bioline :
551 - 600 of 1604 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1.5 µl of sterile water and 7.5 µl SYBR Hi-ROX mix (Bioline). Reaction conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline). Quantitative PCR was performed according to the manufacturer’s instructions (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1.0 unit BioTaq (Bioline USA Inc.), 1 x BioTaq reaction buffer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extraction was performed using the Isolate II RNA Plant kit (Bioline, London, England).
-
bioRxiv - Immunology 2023Quote: ... using random hexamers (Bioline Reagents Ltd) following the manufacturer’s protocol.
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... 0.5 µg of RNA was used to generate cDNA using Tetro cDNA synthesis kit (Bioline BIO-65043) in a 10 µl reaction using a 1:1 ratio of random hexamer and oligo (dT)18 primer mix as per manufacturer instructions ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... RNA was extracted using ISOLATE II RNA Mini kit as per manufacturer instructions (Bioline BIO-52072) and RNA concentration and quality determined by Nanodrop (Thermo Fisher) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we placed at least 50 seeds (exact number of seeds Table S1) per temporal origin on moist potting soil (Einheitserde®, BioLine, Pikiersubstrat) in trays (TEKU® ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Hi-ROX (Bioline). A total cDNA concentration of 100 ng in combination with 200 nM of dapE oligonucleotide per reaction (Supplementary Table 5 ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... First strand cDNA synthesis was performed using the Tetro cDNA synthesis kit (Bioline). Quantitative PCR (qPCR ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... plasmids were extracted (Bioline BIO-52057) and correct insertion of the guide RNA sequence confirmed by sequencing.
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... and gel purified (Bioline BIO-52060) as per supplier protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized by using the SensiFAST cDNA Synthesis kit (Bioline, London, England). Gene expression levels were measured using a MicroAmp Fast Optical 96-well Reaction Plate with Barcode ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT–qPCR was performed using the SensiFAST Syber Low-ROX kit (Bioline) QuantStudio 3 RealTime qPCR (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg of total RNA was retrotranscribed in cDNA using the SensiFAST cDNA Synthesis KIT (Bioline). Specific sets of primer pairs were designed and tested with primerBLAST (NCBI ...
-
bioRxiv - Molecular Biology 2023Quote: ... a dUTP mix (Bioline), containing dATP ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
bioRxiv - Plant Biology 2023Quote: The subsequent amplification step of the PCR was performed using MangoTaq™DNA Polymerase (Bioline, Belgium) and the primers LCO1490 and HCO2198 designed by Folmer et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and diluted 1:10 before quantification using the SensiFAST SYBR No-Rox kit (Bioline, BIO-98005). qRT-PCR was performed with 1 μM of each primer (a common reverse primer for both Trm1 isoforms and isoform-specific forward primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 unit of Taq polymerase (Bioline, Meridian Bioscience). The PCR conditions were an initial melting step of 94°C for 4 min ...
-
bioRxiv - Bioengineering 2023Quote: ... My Taq PCR master mix (Bioline) that included buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 µg of RNA was reverse transcribed to cDNA using SensiFAST cDNA Synthesis Kit (Bioline #65054). qPCR reactions were set up using PowerUp SYBR Green Master Mix (Applied Biosystems #A25742 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR reactions were carried out using 1.25 ng total RNA equivalent RT reaction in sensiFAST SYBR No-Rox mix (Bioline) in presence of 600 nM of each primer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids were purified with the BIOLINE ISOLATE II Plasmid Mini Kit (#BIO-52057; Bioline). Before addition to the one-pot restriction-ligation reaction ...
-
bioRxiv - Microbiology 2022Quote: ... 12.5 μl of MyTaq Red Mix (Bioline) and 0.5 μl of 10 μM of each primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were carried out using 1.5 mM MgCl2 and 1X NH4 buffers for 1U of BioTaq polymerase (Bioline), 0.2 mM dNTP mix ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified RNA (500 ng) was transcribed into cDNA with Tetro cDNA Synthesis Kit (Bioline Reagents Limited, London, UK) to analyze genes expression ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time quantitative PCR (RT-qPCR) reactions were performed (Bioline #BIO-98020). NCBI primer BLAST software was used for oligonucleotide design (Ye et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized with the SensiFAST cDNA Synthesis Kit (Bioline; Cat. No. 65054). Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were prepared for qPCR in technical triplicates in 5 µL reaction volumes using SensiFAST SYBR Lo-ROX 2X master mix (Bioline; Cat. No. BIO-94005), custom qPCR primers from Integrated DNA Technologies used at a final concentration of 0.2 µM ...
-
bioRxiv - Molecular Biology 2022Quote: Cells or frozen tissue samples were homogenised and lysed in TRIsure (Bioline). Total RNA was isolated using EconoSpin All-In-One Mini Spin Columns (EconoSpin 1920-250 ...
-
bioRxiv - Developmental Biology 2022Quote: ... using MyTag polymerase (Bioline GmbH, Germany) according to the manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... One microlitre of Chelex extracted DNA was amplified with the appropriate primers and MyTaq polymerase (Bioline) in a 20 μl volume ...
-
bioRxiv - Neuroscience 2022Quote: ... Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline, BIO-65054) or the iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... qPCR reactions comprised 1X SYBR Green No-Rox (Bioline), 250 nM forward and reverse primers (Supplementary Table 1) ...
-
bioRxiv - Genetics 2022Quote: ... 1X SYBR Green (Bioline), 250 nM primers up to a final volume of 10 μL were cycled using a ViiA7 real-time thermocycler and QuantStudio V1.3 (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... the SensiFAST SYBR No-ROX Kit (Bioline, BIO-98005) was used with primers for Plp1 (Forward ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from samples using the ISOLATE II RNA Micro Kit (Bioline, BIO-52075) or the ISOLATE II RNA Mini Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... or the ISOLATE II RNA Mini Kit (Bioline, BIO-52073). Isolated RNA was reverse transcribed using the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed using the SensiFAST Probe No-ROX Kit (Bioline, BIO-86005) and TaqMan probes for Gapdh (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... The purified DNAs were amplified with SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) by real-time qPCR.
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined with a quantitative real time PCR SYBR Green SensiFAST™ SYBR® No-ROX Kit (Bioline, London, UK) on a Light Cycler® 480 Instrument II (Roche Life Sciences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and maintained with Ribosafe RNAse Inhibitor (Bioline). Quality and quantity of RNA were assessed by Nanodrop (Thermo Scientific) ...