Labshake search
Citations for Millipore Sigma :
1901 - 1950 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... gel-purified PCR products were ligated into the pET15b expression vector (Novagen). Expression in E ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... and inserting the H6-SpeI-mScarlet PCR product into pET28a (Novagen #69864) using NcoI and BamHI ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was carried out using SYBR Green JumpStart Taq ReadyMix (Sigma) using the appropriate primers (Figure 2-source data 1) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... was purified using the GeneElute PCR Clean-Up Kit (Sigma-Aldrich, USA), then labeled with biotin-16-dUTP (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed with the KOD Hot-start 2× master mix (Novagen), and cloning was performed using Gibson Assembly 2× Master Mix (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the region encoding GFP1–10 was PCR amplified (KOD polymerase, EMD Millipore) from pSJ1256 using primers containing the PacI and AscI (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... Mice were genotyped using Extract-N-Amp Tissue PCR Kit (Sigma Aldrich) according to manufacturers’ instructions with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were analysed by electrophoresis on 1% agarose gel (Sigma-Aldrich), containing SafeView (ABM) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was verified by PCR (REDTaq® ReadyMix™ # R4775, Sigma Aldrich). The primers ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen®), following standard protocols ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for qPCR and qRT-PCR were homogenized in TRiZOL (Sigma Aldrich) reagent and further processed for nucleic acid extractions using manufacturer’s protocols.
-
bioRxiv - Evolutionary Biology 2022Quote: ... we purified both libraries using the GenElute PCR Clean-Up Kit (Sigma) to remove short library fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... k-mer sequences were assembled using PCR from oligos purchased from Sigma.
-
bioRxiv - Biophysics 2019Quote: ... coli MG1655 genome by PCR into pET15b (Merck Millipore, Billerica, MA, USA) by Gibson assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... All oligonucleotides used in PCR and cloning were procured from Sigma-Aldrich. XT-20 high fidelity polymerase was used in all cloning protocols and purchased from GeNei Pvt ...
-
bioRxiv - Developmental Biology 2020Quote: ... we prepared this mixture for PCR: 10µL of Taq polymerase (Sigma P0982), 1µL of the premade sex primer stock ...
-
bioRxiv - Microbiology 2020Quote: ... Vectors were generated by inverse PCR using KOD Hot-start polymerase (Novagen) or by Gibson assembly in a homemade reaction master mix (100 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:10 mixed with 1x PCR buffer (Sigma Aldrich), 1.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digested PCR product was cloned into a pET-52b(+) plasmid (Novagen) in frame with an N-terminal Strep-tag II obtaining the B35SSB expression vector pET52b::B35SSB ...
-
bioRxiv - Genomics 2019Quote: ... with the SYBR Green JumpStart Taq ReadyMix for Quantitative PCR (Sigma Aldrich). Using the Primer3 software70 ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... Mice were genotyped using Extract-N-Amp Tissue PCR Kit (Sigma Aldrich) according to manufacturer instructions with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... along with mycoplasma testing using the LookOut Mycoplasma PCR Detection Kit (Sigma).
-
bioRxiv - Immunology 2021Quote: ... and fluorescence imaging and LookOut® Mycoplasma PCR detection kit (Sigma-Aldrich). Primary antibodies used for immunohistochemistry included ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Genetics 2021Quote: ... The PCR master-mix used was: Taq polymerase (Novagen NovaTaq 0.04U/μL), primers (0.5 μM each) ...
-
bioRxiv - Immunology 2020Quote: ... Amplified S-gene and polymerase chain reaction (PCR) engineered pET31b(+) (Novagen, Germany) bacterial expression vector were amplified using 0570F and 0571R primers ...
-
bioRxiv - Biochemistry 2022Quote: ... brucei genomic DNA using PCR and ligated into the pET15b vector (Novagen), which provides an N-terminal His6 tag followed by a thrombin cleavage site prior to the target protein ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was performed using KOD Hot start DNA polymerase (Millipore Sigma) since it has a low error rate unlike Taq polymerase (Engler and Marillonnet 2013) ...
-
bioRxiv - Physiology 2022Quote: ... and purified with the GenElute™ PCR Clean-Up Kit (SIGMA NA1020). 300 ng of the eluted DNA was digested overnight at 37°C with the restriction enzymes including USP8 – BstBI and USP48 – SpeI ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed using JumpStart REDTaq Ready Mix (Sigma, Cat#P0982-800RXN) and the primers listed below ...
-
bioRxiv - Molecular Biology 2022Quote: ... and splice isoform specific PCRs were performed (Sigma Aldrich High fidelity Taq) using appropriate primers (Supplemental table 8 ...
-
bioRxiv - Systems Biology 2022Quote: ... PCR was performed with a proof-reading KOD polymerase (Sigma-Aldrich, 71086) using vector-specific primers.
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was performed using KOD Hot Start Master Mix (Millipore Sigma) with primers listed in Supplementary Table 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Following the RED Extract-N-Amp Tissue PCR XNAT manufacturer’s protocol (Sigma), 2-3mm of each mouse’s tail was removed and DNA was extracted ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (EMD Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... and PCR amplification was performed using KAPA2G ReadyMix Kit (Sigma Aldrich, KK5103) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: PCRs were performed with the KAPA3G Plant kit (Sigma Aldrich, MO, USA) using the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR mixture consisted of MTP Taq DNA Polymerase (Sigma-Aldrich, Germany) (0.05 u/μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sanger sequencing of the PCR products was performed using commercial service (Sigma). The sequencing traces were examined and the fish carrying A to G mutation were selected ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA Polymerase (EMD Millipore). In the via-1 strain ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction contained 1.25 U JumpStartTM Taq DNA Polymerase (Sigma-Aldrich), 1× PCR Buffer (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... blots were incubated for 1 hour rolling at RT in secondary antibody which was anti-mouse antibody raised in sheep (Sigma-Aldrich, St. Louis, MO, USA) diluted 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stimulated by FSK (in the concentration range 1-100 μM) for 30 min at RT in the presence of pan-PDE inhibitor IBMX (500 μM, Sigma-Aldrich, St. Louis, MO, USA). The fluorescence signal ...
-
bioRxiv - Cancer Biology 2023Quote: ... The top part of the membrane was blocked with 3% non-fat milk in Tris-buffered saline with 0.1% Tween (TBST) followed by incubation at room temperature (RT) for 1 h with mouse monoclonal anti-FLAG primary antibody (Sigma-Aldrich, USA; #F3165, 1:2,000) to detect the overexpressed EPHB1 receptors proteins (130 KDa) ...
-
bioRxiv - Microbiology 2023Quote: ... contained in 24-well microplates with flat bottom were fixed with PBS/4% paraformaldehyde for 15 min at room temperature (RT) and permeabilized with 0.1% Triton X-100 (Sigma, Chemical Company, St. Louis, MO, USA) for 15 min at RT ...