Labshake search
Citations for Millipore Sigma :
1701 - 1750 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... They were blocked in 1% BSA in PBT for 1hr at RT and incubated overnight at 4°C with the monoclonal mouse anti-FLAG M2 antibody (Sigma, F1804) diluted 1:500 in 1% BSA/PBS ...
-
bioRxiv - Cell Biology 2024Quote: Retinal cryosections were rehydrated in 1X phosphate buffered saline (1X PBS) for 20 minutes at room temperature (RT) followed by incubation in 1.75 µg/mL Nile Red (Sigma, Cat# N3013) in 100% acetone for 1-hour at RT in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was stained with DAPI (1 mg/ml in water) for 5 min at RT and coverslips were mounted in fluoroshield (Sigma-Aldrich).
-
bioRxiv - Immunology 2024Quote: Tissues were then washed with wash buffer and blocked for 11 hours at RT with 1X TBS with 5% (v/v) normal donkey serum (Sigma-Aldrich). The first antibody cocktail was prepared in 1X TBS-T 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... iPSC-CMs were cultured on Matrigel-coated coverslips and fixed at day 60 of differentiation in 4% Roti-Histofix (Carl Roth) at RT for 10 min and blocked with 1% Bovine Serum Albumin (BSA; Sigma-Aldrich) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Microbiology 2022Quote: The TAR vector for assembly of the full-length genome was amplified from pCC1BAC-ura3 using primers ConCMVpR and ConBGHtermF with KOD Xtreme Hot Start DNA polymerase (Millipore, Burlington, MA).15 The CMV promoter was amplified from HCMV Toledo genomic DNA using primers CMVpromF and CMVpromR ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified from pBluescript II with SalI adapters using primers KL215 and KL216 and KOD Hot Start DNA polymerase (Millipore 71842-3). The PCR product was purified using a QIAquick PCR Purification Kit (Qiagen 28104) ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Coding sequence for human SATB2 was amplified from the IMAGE cDNA clone MGC:119475 IMAGE:40007830 using gene specific primers and were cloned into EcoRI and XbaI digested 3xFLAG-CMV9 vector (Sigma Aldrich, USA). Sequences of all the expression constructs were confirmed using Sanger sequencing and validated for expression using immunoblotting experiments ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: Synthetic oligonucleotides against target mRNAs (listed below) with T7 RNA polymerase promoter sequence on the 5’ end of the reverse primers were obtained commercially (Sigma Aldrich, India). cDNA templates for corresponding stages were used for PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random primer according to the manufacturer’s recommendations and the final products diluted with 2 volumes of Milli-Q water (EMD Millipore, Hayward, CA). This final cDNA sample served as a template for RT-PCR and qPCR with the primers listed in STable 1.
-
bioRxiv - Cell Biology 2024Quote: ... The FOXP3 TSDR regions were then amplified from the converted sample gDNAs by qPCR using specific primers (forward: TTGGGTTAAGTTTGTTGTAGGATAG, reverse: ATCTAAACCCTATTATCACAACCCC, Sigma Aldrich, USA) and Precision Melt Supermix (Biorad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was performed in the Applied Biosystems 7500 FAST real-time PCR system using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich, St Louis, US). Transcript levels of target genes were determined via the 2-ΔΔCt method (Livak & Schmittgen ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with an Applied Biosystems 7500 Real-Time PCR system using KiCqStart®SYBR®Green qPCR ReadyMix™ (Millipore-Sigma). Gene expression was normalized to the internal control 18S rRNA ...
-
bioRxiv - Microbiology 2020Quote: ... Samples for qRT-PCR were homogenized in TRiZOL (Sigma Aldrich) reagent and further processed for RNA extractions.
-
bioRxiv - Biophysics 2020Quote: ... PCR was performed with KOD Hot Start DNA polymerase (Novagen) and oligonucleotides were synthesized by Sigma Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR was completed using RedExtract ReadyAmp Taq (Sigma, SIG-R4775) with the following cycle conditions (29 cycles) ...
-
bioRxiv - Immunology 2019Quote: ... Indexed PCR product was separated on 2%-LMP agarose (Sigma) and purified with the Gel Extraction Kit (Qiagen).
-
bioRxiv - Biochemistry 2019Quote: ... Venor GeM PCR-based mycoplasma detection kit was from Sigma. ECL substrate and ECL-Plus substrate were from Pierce and were used as directed ...
-
bioRxiv - Genetics 2020Quote: ... the PCR products were separated on 2% agarose gel (Sigma) for 2 h at 70V ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions used either KOD Hot Start DNA Polymerase (Sigma) or iProof DNA Polymerase (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the promoter and the resistance gene expression cassette with primers ML4154/ML4155 that also carry 30 bp homology with the 5 end of the TgNFS2 gene ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML5116/ML5117 (TgSDHB ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML3978/ML3979 (TgNFS2 ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR products were separated in gels containing 1% agarose (Sigma) in Tris-acetate buffer (TAE) ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR product was incorporated into the pET28a(+) vector (Novagen) between its NdeI and Xhol restriction sites using standard molecular biology protocols ...
-
bioRxiv - Biochemistry 2022Quote: ... The PCR product was cloned into pET-19b plasmid (Novagen) and sequence verified ...
-
bioRxiv - Microbiology 2022Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the promoter and the resistance gene expression cassette with primers ML4107/ML4108 that also carry 30□bp homology with the 5□ end of the TgSUFC gene ...
-
bioRxiv - Bioengineering 2019Quote: ... premix REDTaq® ReadyMixTM PCR Reaction Mix (Sigma-Aldrich, USA,) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR products were revealed by ethidium bromide (Sigma-Aldrich) staining ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Taq DNA polymerase and PCR buffers were purchased from Sigma, India ...
-
bioRxiv - Genomics 2020Quote: ... qRT-PCR was performed with KAPA SYBR® FAST (Sigma) on a Rotor-Gene Q (Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... qRT–PCR was performed with KAPA SYBR® FAST (Sigma) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR stages used the KOD HotStart Polymerase Kit (Sigma-Aldrich); In-gel DNA extraction steps used the E.Z.N.A gel extraction kit (omega BIO-TEK) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using the GenElute kit (Sigma Aldrich) and concentrations were checked using a NanoDrop ND1000 (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were mycoplasma free (LookOut Mycoplasma PCR detection kit, Sigma). Cells were passaged with 0.05% trypsin-EDTA every 2-3 days ...
-
bioRxiv - Genetics 2021Quote: ... His-TCF7 was PCR cloned into pET52b (Millipore, 71554-3) using the primers 5’-CGGGGTACCTCATGCCGCAGCTGGACTCC-3’ and 5’-ATAGTTTAGCGGCCGCGAGCACTGTCATCGGAAGGAAC-3’ ...
-
bioRxiv - Genetics 2020Quote: ... each PCR well contained: 10 μL REDTaq ReadyMix (Sigma-Aldrich), 8.2 μL dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... from the Kap2G Robust PCR kit (Sigma-Aldrich, Gillingham, UK) and 9 µL added to each well in a 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... These PCR products were cloned into pET-28b(+) (Novagen, USA) to construct tagged Fnr proteins with His-tag at the N-terminus of Fnr1 and C-terminus of Fnr3 respectively ...
-
bioRxiv - Immunology 2021Quote: ... as confirmed by the LookOut Mycoplasma PCR Detection Kit (Sigma). Cell lines were authenticated by the ATCC ...
-
bioRxiv - Plant Biology 2021Quote: ... with PCR reactions using FastStart Taq DNA Polymerase (Sigma-Aldrich), which does not have proofreading activity ...
-
bioRxiv - Cell Biology 2022Quote: ... in PCR tubes containing lysis buffer (0.2% Triton (Sigma Aldrich), 0.4 U/µL RNaseOUT (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML3980/ML3981 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were separated using 1% agarose gels (Sigma-Aldrich) dyed with SYBR Safe (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: ... the inserts were PCR amplified with KOD HotStart Polymerase (Novagen) and verified by Sanger sequencing.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products were cloned into pET15b expression vector (Novagen) between NdeI and BamHI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and cDNA purification (Genelute PCR clean-up kit, Sigma-Aldrich) were carried out ...
-
bioRxiv - Microbiology 2023Quote: ... purified with the GenElute PCR Clean-up kit (Sigma Aldrich) again ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was performed with KAPA SYBR® FAST (Sigma) on Rotor-Gene RG-3000 A (Corbett Research).