Labshake search
Citations for Millipore Sigma :
7301 - 7350 of 7813 citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... PLA was performed using the Duolink in situ PLA kit according to the manufacturer’s instructions (Millipore Sigma, DUO92002, DUO92004 and DUO92014). In brief ...
-
bioRxiv - Cancer Biology 2022Quote: RAS and RAC activity were measured using a RAF-1 RBD and PAK-1 PDB pull-down assay kits respectively (Cat#17218 and Cat#14325, Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The precipitated proteins were used for determination of protein content using a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich, Taufkirchen, Germany).
-
bioRxiv - Microbiology 2021Quote: ... for pathological examination.Paraffin-embedded lung tissue sections were also stained for the presence of fungal structures using the Silver Stain Kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total carbohydrate was determined by the Dubois phenol-sulfuric acid method (76) adapted to a 96-well plate assay with the Total Carbohydrate Assay Kit (MAK 104, Sigma-Aldrich), using D-glucose as the standard and absorbance read at a wavelength of 490 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... avidin biotin was added to attach peroxidase (ABC kit; Vector, PK-4000) and sections reacted with DAB and urea peroxidase (Sigmafast, D4293, Sigma Aldrich) until the reaction product was clearly visible.
-
bioRxiv - Microbiology 2021Quote: ... DNA was then extracted from 2 mL of cell culture using a GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, USA). DNA samples were subjected to an initial quality check using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then biotinylated by click-it reaction according to the manufacturer protocol (Click-iT® Nascent RNA Capture Kit; Life technology) and precipitated with EtOH (Sigma) and Na-acetate (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Genomics 2020Quote: Nuclei were isolated from ~100mg of frozen frontal cortex brain tissue from Brodmann area 9 at the HIHG using the Nuclei Isolation Kit: Nuclei EZ Prep (Sigma, #NUC101). All tissues were homogenized in ice-cold EZ Lysis buffer with a glass-on-glass dounce homogenizer ...
-
bioRxiv - Microbiology 2021Quote: Cell viability and cytotoxicity of antibiotics and peptides were determined against human corneal epithelial cells (HCE-2, CRL-11135, ATCC, Manassas, Virginia, USA) using cell-counting-kit-8 (CCK-8) assay (Sigma Aldrich, Merck Life Science UK Limited ...
-
bioRxiv - Microbiology 2021Quote: ... We then used these primers (TTCGTCGTGAGACAGAGCGG, AGGCCATTGACGGATGGTTTGTAC) to amplify DNA from the two positive mosquitoes using the Expand™ Long Range dNTPack kit (Sigma) using the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: Genomic DNA from all the endpoint populations was extracted using GenElute Bacterial Genomic DNA Kit (NA2120; Sigma-Aldrich, St. Louis, MO) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Protein concentration was determined by the bicinchoninic acid protein assay kit (BCA-Pierce, USA) using bovine serum albumin (BSA, Sigma-Aldrich) as standard.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was removed and the cell pellet was resuspended in 500 μL Diluent C containing 2 μL PKH67 dye (PKH67 Green Fluorescent Cell Linker Kit, Sigma-Aldrich), incubated for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... samples were centrifuged at 10,000g for 5 min and the Acetyl-CoA measurement was performed in a 96-well plate using the Acetyl-Coenzyme A Assay Kit (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Lactate dehydrogenase (LDH)-based cytotoxicity levels were determined by evaluation of LDH release into the cell culture supernatants using Lactate Dehydrogenase Activity Assay kit (MAK066, Sigma-Aldrich). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... Methylated mRNA was eluted by free m6A from the beads and purified with the GenElute™ mRNA Miniprep Kit (MRN70, Sigma). One tenth of the fragmented RNA was saved as an input control for standardization ...
-
bioRxiv - Biochemistry 2021Quote: ... after 4 hours cells were fixed in 3.7% paraformaldehyde/30 mM sucrose for 10 min and processed either for the is-PLA experiment by using the Duolink PLA kit (DUO92007, Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was prepared from an overnight culture in THB-Y broth and high-molecular-weight genomic DNA was isolated using the Sigma Genelute kit (Sigma Aldrich) according to the manufacturer′s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed in 70% ethanol for 1 h and stained for 10 min with an ALP staining solution (BCIP/NBT alkaline phosphatase kit, Sigma-Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were lysed by bead-beating in the presence of buffer RA-1 (NucleoSpin RNA isolation kit, Mackery-Nagel) and β-mercaptoethanol (Sigma). RNA isolation and purification was continued according to the protocol supplied by the manufacturer (Nucleospin RNA isolation kit ...
-
bioRxiv - Microbiology 2022Quote: ... Isopropanol was mixed with the aqueous phase and RNA was isolated as per the GenElute Mammalian Total RNA Miniprep kit (RTN350, Millipore Sigma) protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... catalysis (ChE activity) were determined either as previously described (Hagstrom et al. 2017) or using an Acetylcholinesterase Activity Assay Kit (Sigma-Aldrich). Absorbance was read at 412 nm every minute for 10 minutes using a VersaMax (Molecular Devices ...
-
bioRxiv - Genomics 2022Quote: ... The next day the DNA was extracted from 500 µl of culture using the GeneElute bacterial genomic DNA kit (Sigma-Aldrich). gDNA was quantified ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secretion of the following cytokines was quantified with the MILLIPLEX® Human CD8+ T Cell Magnetic Bead Panel Premixed 17 Plex - Immunology Multiplex Assay kit (EMD-Millipore): IL-6 ...
-
bioRxiv - Genomics 2019Quote: Aphid samples were ground to a fine powder and total RNA was extracted using a plant RNA extraction kit (Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic DNA was isolated from expanded clones after the second FACS sorting step using the GenElute mammalian genomic DNA miniprep kit (Sigma-Aldrich) and amplified in a PCR reaction using primers P1/P5 (Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The supernatant was kept for proteomics analysis and electrophoresis followed by silver staining after addition of fresh 6x sample buffer (ProteoSilver Silver Stain Kit, Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: Ribonucleoprotein complex immunoprecipitation (RIP) was performed using the EZ-Magna RIP RNA-binding protein Immunoprecipitation Kit (Merck Millipore Billerica, Massachusetts, USA). Huh7.5-SGR cells were seeded in Petri dishes at 106 cells/dish for 24 h prior to transfection with pKSRP-HA plasmids ...
-
bioRxiv - Developmental Biology 2019Quote: ... H9 hESCs were nucleofected using the Lonza P3 Primary Cell 4D-Nucleofector X Kit and monoclonal colonies were selected for 7-10 days with 1 μg/ml of puromycin (Sigma-Aldrich). Tetracycline hydrochloride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: RNA isolation was carried out with 2 g of soil using RNA PowerSoil Total RNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA. USA) with phenol chloroform isoamyl alcohol 25:24:1 (Sigma-Aldrich) following the instructions of the manufacturer and resulting in 100 μL of RNA solution ...
-
bioRxiv - Genomics 2019Quote: ... with 2 mL of ice-cold EZ-Prep lysis buffer from the Nuclei EZ-prep Isolation Kit (Sigma, Cat #NUC-101). The tissue was dounced 25 times with Pestle A ...
-
bioRxiv - Cell Biology 2019Quote: ... the ligation experiment was performed according to the manufacturer’s instructions using the Duolink® In Situ Orange Starter Kit Goat/Rabbit (Sigma-Aldrich). Briefly ...
-
bioRxiv - Systems Biology 2019Quote: ... Cells were then lysed by using lysis buffer and ATP activity was analyzed by using the Adenosine 5’-triphosphate (ATP) Bioluminescent Assay Kit (Sigma-Aldrich) according to manufacturer instructions ...
-
bioRxiv - Physiology 2019Quote: ... TG content of cells before and at the end of adipogenic differentiation was performed as previously described (Dirat et al, 2011) using commercial kit (Sigma-F6428).
-
bioRxiv - Molecular Biology 2020Quote: ... The template for the bulk DNA probe was generated using isolated nuclei (Galbraith et al., 2011) and GenElute™ Plant Genomic DNA Miniprep Kit (Sigma).
-
bioRxiv - Genomics 2019Quote: ... Individual colonies were cultured overnight before isolation of plasmid DNA using the GenElute™ miniprep kit (Sigma-Aldrich, Catalogue No. PLN350). Purified plasmids were Sanger sequenced to confirm successful cloning ...
-
bioRxiv - Microbiology 2019Quote: ... These clones were grown separately overnight in lysogeny broth (LB) medium and used for plasmid extraction with GenElute Plasmid Miniprep Kit (Sigma-Aldrich). PCR amplifications ...
-
bioRxiv - Immunology 2019Quote: ... Osteoclast generation was verified directly by phase contrast microscopy or after staining for Tartrate-Resistant Acid Phosphatase (TRAP) (Leukocyte Acid Phosphatase kit, Sigma-Aldrich). Human TNFα and CCL2 in M-MØ culture supernatants were measured using commercially available ELISA (BD Biosciences).
-
bioRxiv - Immunology 2019Quote: ... Neutrophil viability was measured using Muse Annexin V and Dead Cell Assay Kit on a Muse Cell Analyzer mini-flow cytometer (EMD Millipore).
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from the si-NC and si-Dnmt3aos-transfected M(IL-4) macrophage cells and was then treated with bisulfite using the Imprint DNA Modification Kit (Sigma-Aldrich). Bisulfite sequencing and pyrosequencing were conducted by Shanghai Sangon Biotech Corporation ...
-
bioRxiv - Genetics 2020Quote: ... the immune peroxidase was detected using a Vectastain ELITE ABC kit (Vector) and visualized with a solution of diaminobenzidine (Sigma Aldrich) in the presence of 0.01% H2O2 ...
-
bioRxiv - Immunology 2019Quote: Lactate concentration in the extracellular medium of T cells cultured under Th17-polarizing conditions for 96h was performed using the Lactate Assay kit from Sigma-Aldrich according to manufacturer’s instructions.
-
bioRxiv - Pathology 2020Quote: ... 120 or 180 min after the blood collection) was addressed spectrophotometrically using Lactate Dehydrogenase Activity Assay Kit (MAK066, Sigma Aldrich, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: Viability of the slices was assessed by measuring the ATP content per milligram tissue using a bioluminescence assay kit (Sigma-Aldrich) as previously reported by Hadi et al ...
-
bioRxiv - Physiology 2021Quote: ... The supernatant was collected and used immediately in a commercial urease activity assay kit (Sigma-Aldrich MAK120, St. Louis, MO, USA).
-
bioRxiv - Microbiology 2020Quote: ... RNA was converted to cDNA using the First Strand cDNA synthesis kit for reverse transcription (avian myeloblastosis virus [AMV]; Millipore-Sigma). Quantitative real-time PCR (qRT-PCR ...