Labshake search
Citations for Addgene :
3051 - 3100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... plasmids were procured from Addgene. For expressing cDNA using lentivirus ...
-
bioRxiv - Molecular Biology 2024Quote: pcDNA3 -HA3-TSC1 (Yue Xiong; Addgene #19911), pcDNA3 Flag TSC2 (Brendan Manning ...
-
bioRxiv - Molecular Biology 2024Quote: ... pcDNA3 Flag TSC2 (Brendan Manning: Addgene #14129), LentiCRISPR v2 (Feng Zhang ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2009) for measurement of [ATP]mito was a gift from Hiromi Imamura, Laconic (San Martín et al., 2013) (Addgene plasmid #44238) for measurement of [LAC]cyto and assessment of the Warburg index was a gift from Luis Felipe Barros ...
-
bioRxiv - Molecular Biology 2024Quote: ... RHEB sequence from pRK7-RHEB (John Blenis; Addgene #15888) was cloned into the LentiExp vector by replacing SpCas9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... LentiCRISPR v2 (Feng Zhang; Addgene #52961) plasmids were procured from Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: NIH3T3 cells were transduced with lentiCRISPR v2 (Addgene plasmid #52961) containing either no sgRNA (control ...
-
bioRxiv - Cancer Biology 2024Quote: PB-TRE3G-MYCN and XLone-GFP (21) were acquired from Addgene. Plasmid information is provided in Supplementary Table S1 ...
-
bioRxiv - Cell Biology 2024Quote: ... with packaging vectors psPAX2 and pMD2.G (Addgene plasmids #12260 and #12259). HEK293 cells were transfected with expression and packing plasmids following standard calcium phosphate or polyethylenimine (Polysciences #23966 ...
-
bioRxiv - Cell Biology 2024Quote: ... Murine Ptch1tg and Ptch1ΔL2 were generated from Ptch1 Full Length (pcDNA-h-mmPtch1-FL, Addgene #120889). Ptch1ΔL2 was generated by deletion of the second extracellular loop (L2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Cell Biology 2024Quote: ... pRK5-EGFP-Tau AP was a gift from Karen Ashe (Addgene plasmid no ...
-
bioRxiv - Developmental Biology 2024Quote: ... The UBQ10 promoter was amplified from the UPG plasmid162 (Addgene # 161003) using primers OutALFd and UsfGM-R1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The first plasmid encodes the inserted sequence flanked by two microhomology arms with a length of 40 bp and containing short PITCh sequences at their distal ends (modified based on pCRIS-PITChv2-FBL, Addgene #63672) (Sakuma et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... sfGFP sequence was amplified from the 35S-sfGFP-nosT plasmid161 (Addgene # 80129) using primers UsfGM-F1 and UsfGnes-R1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The UBQ3 terminator was amplified from the UPG plasmid162 (Addgene # 161003) using primers UsfGnes-F1 and OutALRb ...
-
bioRxiv - Cell Biology 2024Quote: ... PB-TRE was used as backbone (Addgene, Cat# 63800). Pool of transfected IκBα-KO mESCs was selected by Hygromycin (100µg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sensor plasmids used in this study comprised the following: D1ER (Palmer et al., 2004) (Addgene plasmid #36325) for measurement of [Ca2+]ER and 4mtD3cpV (Palmer et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pCDNA3mycIRESGFP plasmid was created by introducing the BamHI-XhoI fragment of pWZL Blast myc (Addgene plasmid #10674) containing the c-Myc cDNA in BamHI-XhoI restricted pcDNA3.1(+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and envelope plasmid pMD2.G (Addgene plasmid #12259) using the X-tremeGENE™ 9 DNA Transfection Reagent (#6365809001 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The RUNX1 HDR template was subcloned into plasmid pUC19 (Addgene, #50005), linearized by PCR and concentrated by isopropanol precipitation to achieve a concentration ≥1 µg/µl ...
-
bioRxiv - Biophysics 2024Quote: Haspin plasmid construct (GSG2) was a gift from Nicola Burgess-Brown (Addgene plasmid # 38915 ...
-
bioRxiv - Biophysics 2024Quote: Haspin plasmid construct (GSG2) was a gift from Nicola Burgess-Brown (Addgene plasmid # 38915; http://n2t.net/addgene:38915; RRID:Addgene_38915). This construct was used to create Haspin mutant constructs using around-the-horn mutagenesis ...
-
bioRxiv - Biophysics 2024Quote: The WW4-HECT domain (residues 560-994 of Addgene #2700), corresponding to residues 541-975 in the canonical full-length human NEDD4-2 sequence (Uniprot id ...
-
bioRxiv - Biophysics 2024Quote: ... psPAX2 (1.3 pM) and pMD2.G (0.72 pM) (Addgene: 137725, 12260 and 12259). 6h transfection was performed with Lipofectamine 3000 following manufactures protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into the pLV hUbC-dCas9 KRAB-T2A-GFP plasmid (Addgene #672620). HEK 293T cells were infected with this lentivirus to induce expression of dCas9-KRAB,43 followed by transduction ...
-
bioRxiv - Cell Biology 2024Quote: ... EGFP-BAF (Addgene #101772); Emerin pEGFP-C1 (637 ...
-
bioRxiv - Cell Biology 2024Quote: ... Stargazin-dCherry-FRB (Addgene #172444); Stargazin-GFP-LOVpep (Addgene #80406) ...
-
bioRxiv - Cell Biology 2024Quote: ... Stargazin-mCherry-FRB (Addgene #172443) (Ferrandiz et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... pSBtet-Lyn10-TurboID-V5-puro and pCMV(CAT)T7-SB100 (Addgene 34879) were co-transfected into Flp-In T-Rex HeLa cells in a 19:1 ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... 18 million 293FT cells were seeded in T225 flasks (40 flasks in total) and transfected the following day with 3.4 μg pMD2.G (Addgene #12259), 6.8 μg psPAX2 (Addgene#12260) ...
-
bioRxiv - Cell Biology 2024Quote: ... 6.8 μg psPAX2 (Addgene#12260), and 13.6 μg lentiviral target (CRISPR ...
-
bioRxiv - Cancer Biology 2024Quote: The Human Brunello CRISPR KO library was a gift from David Root and John Doench (Addgene #73179) (Doench ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.83 µg of psPAX2 (Addgene plasmid # 12260), and 1.1 µg of sgRNA or shRNA plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were co-transfected with 0.56 µg of pMD2.G (Addgene plasmid # 12259), 0.83 µg of psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Cancer Biology 2024Quote: NAMPT enhancer deletions were generated by cloning the first sgRNA targeting upstream of the enhancer into TLCV2 and the second sgRNA targeting 1kb downstream of the first sgRNA into pSpCas9(BB)-2A-GFP (PX458) (Addgene; 48138) which had Cas9 and EGFP replaced with RFP.
-
bioRxiv - Cancer Biology 2024Quote: shMAFG cells were generated using pLKO.1 (Addgene; 10878) cloned with shRNA sequences (Supplementary Table ...
-
bioRxiv - Cancer Biology 2024Quote: pLenti CMV V5-LUC Blast (Addgene; 21474) was used for luciferase overexpression.
-
bioRxiv - Cancer Biology 2024Quote: Fn14 CRISPR KO cells were generated using TLCV2 (Addgene; 87360) cloned with two different sgRNA guides ...
-
bioRxiv - Cancer Biology 2024Quote: The TWEAK overexpression construct was generated by amplifying the soluble TWEAK (sTWEAK) sequence from cDNA through PCR and this was cloned into pLJM1-EGFP (Addgene; 19319), replacing EGFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... NAMPT and mouse Fn14 CRISPR KD cells were generated using lentiCRISPR v2 (Addgene; 52961) cloned with two different sgRNA guides.
-
bioRxiv - Cancer Biology 2024Quote: Cas9-gRNA-GFP vector (Addgene #124770) as described earlier (Giuliano et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into the lentiGuide-Puro vector (Addgene #52963). The finished library consisted of 494 sgRNAs targeting 155 human and mouse genes ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: The all-in-one version of the Human CRISPR knockout Pooled Library (Addgene #73179) was applied for in vitro genome-wide loss-function screen in PaTu-8988t cells23 ...
-
bioRxiv - Cell Biology 2024Quote: ... pX330 (Addgene) was digested with BbsI ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV/TO V5-LUC Puro (Addgene plasmid #19785) was a gift from Prof ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pUMVC (Addgene #8449) were a gift from Prof ...
-
bioRxiv - Cancer Biology 2024Quote: ... envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455) packaging plasmid using polyethylenimine in 150 mm cell culture plates ...