Labshake search
Citations for Addgene :
2851 - 2900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... with plasmids pCFJ210 (#30538 Addgene), pJA245 #21506 Addgene) ...
-
bioRxiv - Cell Biology 2024Quote: ... pCM1.36 (#17249 Addgene). This reaction created a plasmid for MoSCI insertion in chromosome I (4348 ...
-
bioRxiv - Cell Biology 2024Quote: ... NIH (Addgene: #51465) and was previously described in (Várnai and Balla ...
-
bioRxiv - Cell Biology 2024Quote: ... MDA-MB-231 cells were transfected with the engineered pSBtet-BP::eGFP-PLCδ-PH and pCMV(CAT)T7-SB100 plasmid (Addgene, Plasmid #34879) using FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-DRP1 (Addgene #191942), mCherry-Fis18 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2.5μg of the pMD2.G (#12259 Addgene), and 7.5μg of the psPAX2 (#12260 Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 7.5μg of the psPAX2 (#12260 Addgene) using 60μL of 25μM PEI (24765 Polysciences) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The mCherry-luciferase expressing 22Rv1 derivatives were generated using a lentiviral plasmid (pCDH-EF-eFFly-T2A-mCherry; Addgene #104833). Cell lines with high reporter expression were obtained by FACS sorting.
-
bioRxiv - Biophysics 2024Quote: ... plasmids are available from Addgene.
-
bioRxiv - Bioengineering 2024Quote: ... except those purchased from Addgene and the human-derived fusogens ...
-
bioRxiv - Bioengineering 2024Quote: ... #174863) were purchased from Addgene and their sequences were validated by restriction enzyme digestion and partial re-sequencing.
-
bioRxiv - Bioengineering 2024Quote: ... VSVg was expressed from the pMD2.G plasmid (Addgene #12259).
-
bioRxiv - Cell Biology 2024Quote: ... (Addgene nos ...
-
bioRxiv - Cell Biology 2024Quote: ... into the pDONOR MCS Rosa26 plasmid (Addgene #37200) containing Rosa26 homology harms ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Genetics 2024Quote: ... pSpCas9n(BB)-2A-GFP (PX461) was a kind gift from Feng Zhang (Addgene plasmid #48140 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259) and pMD2.G envelope construct (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Zhang (Addgene plasmid #48138), using the following primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cloned into pLKO.TRC vector (Addgene, 10878). The PDE1A- FLAG overexpression plasmid was synthesized by GenScript (Nanjing ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMD2.G (Addgene), TKOv3 library plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... was acquired from Addgene (Watertown, MA, USA) and expanded 1000-fold using the electroporation method ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were selected from either the Brunello (human) or Brie (mouse) libraries and cloned into either lentiCRISPR v2 or lentiCRISPR v2-Blast (Addgene #83480). Lentivirus was produced and used to infect indicated cell lines ...
-
bioRxiv - Cell Biology 2024Quote: ... and a Per2:luc reporter (Addgene 212035) contained in lentiviral transfer vectors (referred to as pLV6-Bmal-luc vector and pLV6-Per2-luc vector respectively) ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded at 30 000 cells/cm2 and transfected 24 h after with the calcium reporter pCAG mito-GCaMP5G, a generous gift from Franck Polleux (Kwon et al., 2016) (Addgene plasmid # 105009 ...
-
bioRxiv - Cell Biology 2024Quote: ... Krummel (Addgene plasmid #38297); pAcGFP-Sec61β from E ...
-
bioRxiv - Cell Biology 2024Quote: ... The sgRNA target sequences were subsequently incorporated into the multicloning site of pSpCas(BB)-2A-Puro (Addgene) using BbsI-HF (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: Psv2-neo plasmid containing HLA-A2/Kb was a gift from Linda Sherman (Addgene #14906, USA) [12] ...
-
bioRxiv - Cell Biology 2024Quote: pMRX-IP/Venus-mULK1 was a gift from Noboru Mizushima (Addgene plasmid #58743; http://n2t.net/addgene:58743; RRID:Addgene_58743)31 ...
-
bioRxiv - Microbiology 2024Quote: ... Ryder (Addgene plasmid # 60356 ...
-
bioRxiv - Microbiology 2024Quote: ... Ryder (Addgene plasmid # 60356; http://n2t.net/addgene:60356; RRID: Addgene_60356) (20) ...
-
bioRxiv - Neuroscience 2024Quote: All viruses are made in-house except for pAAV5-CAG-dLight1.1 (Addgene, 111067) which was used for the photometry recordings.
-
Development of a genetically encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2024Quote: ... adeno-associated virus encoding AAV8-hSyn-DIO-hM3Dq.mcherry (Addgene #44361 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hSyn-DIO-MCS is pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene cat# 44361) which had previously had the BsrGI/NheI region containing hM3D(Gq)-mCherry replaced with the following multiple cloning site ...
-
bioRxiv - Neuroscience 2024Quote: ... Cre-dependent AAVs expressing GCaMP6s (AAV9-Syn-DIO-GCaMP6s, Addgene Cat. No 100845-AAV9) and Nb-Ft-TRPV1Ca2+-HA/mCherry were injected bilaterally into the dorsal striatum of A2a-Cre transgenic mice to restrict expression of GCaMP6s and NbFt- TRPV1Ca2+-HA or mCherry to D2 iSPNs ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-JET-DIO-Nb-Ft-TRPV1Cl- and pAAV-JET-DIO-TRPV1Ca2+ and was made by replacing the BsrGI/NheI region of pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene Cat No. 44361) with a multiple cloning site (TGTACAACTAGTACCGGTTCGCGAGCATGCCCTAGGGCTAGC ...
-
bioRxiv - Pathology 2024Quote: ... the HA-hOPA1-myc sequence was amplified and inserted into pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (ID36432, Addgene, USA) digested with NotI and XbaI using primers with the N-terminal containing the Kozak and HA sequences (TTACTTCAGGCGGCCGCGGCCAAAATGTACCCATACGATGTTCCAGATTAC ...
-
bioRxiv - Synthetic Biology 2024Quote: The pTECH vector was a gift from Dieter Söll (Addgene plasmid #104073).16 Genes were ordered as codon optimized fragments from Twist Bioscience ...
-
bioRxiv - Neuroscience 2024Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... together with pLentiRhoA2G (Addgene: 40179). Media was changed after 6 h to neuronal N2 media ...
-
bioRxiv - Neuroscience 2024Quote: ... and VSV g-glycoprotein Env (pMD2.G Addgene: 12259), together with pLentiRhoA2G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... lenti-Cas9-Blast plasmids (52962; Addgene) for stable expression of CAS9 protein were used as previously described (5) ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was also inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... and lentiSAMv2 (#75112, Addgene) containing the sgRNAs to activate PIEZO1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with lentiviral particles containing the plasmids lentiMPHv2 (#89308, Addgene) and lentiSAMv2 (#75112 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were transfected with the luciferase reporter construct TBS-Luc (8XGTIIC-Luc, cat. 34615, Addgene, 8xGTIIC-luc was a gift from Stefano Piccolo) ...
-
bioRxiv - Genetics 2024Quote: ... All plasmids reported here are available from Addgene under plasmid numbers 204289-204312.
-
bioRxiv - Cancer Biology 2024Quote: ... Expression vectors were generated by cloning into pInducer20 (gift from Stephen Elledge, Addgene plasmid 440181) using the Gateway LR Clonase II enzyme mix (Invitrogen 11791020) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Patrick Salmon (Addgene plasmid # 45956).
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-CamKII-0.4-Cre-SV40 (Addgene, cat# 05558-AAV9) and AAV5-U6-Cacna1eAC-EFS-GFP-KASH was injected into the NAcLat ...