Labshake search
Citations for Addgene :
2701 - 2750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... a total of 9.45 μg of the library plasmid combined with 6.75 μg lentiviral packaging vector psPAX2 and 1.36 μg vesicular stomatitis virus G (VSV-G) envelope expressing plasmid pMD2.G (Addgene plasmids 12260 and 12259) were transfected with the JetPRIME (VMR ...
-
bioRxiv - Developmental Biology 2024Quote: pCS2-nls-zCas9-nls (47929) and pT7-gRNA (46759) were bought from Addgene. The CRISPR RNA (crRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... David Sabatini and Kris Wood (Addgene plasmid #64613; http://n2t.net/addgene:64613; RRID: Addgene_64613) (Martz et al ...
-
bioRxiv - Physiology 2024Quote: Mice with cardiac myocyte-specific overexpression of Ffar4 (CM-Ffar4-Tg) were developed using the CAG-CAT system (Plasmid: 53959, Addgene, Watertown, MA, USA).22 Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The lentiviral backbone is a third-generation vector derived from Addgene #17297.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µg of the packaging plasmid (psPAX2, Addgene #12260), and 2 µg of the envelope plasmid (pMD2.G / VSVG ...
-
bioRxiv - Synthetic Biology 2024Quote: ... which was PCR-amplified from one of our previously described plasmids (Addgene #132667)36 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The pCMV Blast Dest lentiviral expression vector (Addgene #17451)67 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pYFAC-ubi-M-pyrG (Addgene ID# 184498) and pYFAC-ODC-pyrG were built by isothermal assembly using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A1510: pMOD_A1510 (#91036, Addgene) CRISPR knockout system in maize ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 140 ng pMD2.G (Addgene Plasmid #12259), and 480 ng of pLKO (Addgene Pladmid #10878 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... obtained from pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG (Addgene #155305), in the previous cloned pUt-mNF-GFP RMCE plasmid28 (Addgene #199220) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and pcDNA-Cas9-T2A-STOP-TdT (Addgene Plasmid #126425) were ordered from Addgene9 ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid pBEST-OR2-OR1-Pr-UTR1-deGFP-T500 (Addgene 40019) was the kind gift of Vincent Noireaux (The University of Minnesota) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... we used one of our previously established plasmids that harbors the wild-type hTdT gene in a pcDNA3.1 backbone (Addgene #126450)36 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting 4xU6:sgRNA sequence was PCR amplified and ligated into the backbone of pDestTol2pA2-U6:gRNA (Addgene plasmid 63157) after the vector was first digested with ClaI and KpnI to generate the pDestTol2pA2-4xU6:sgRNA plasmid ...
-
bioRxiv - Developmental Biology 2024Quote: ... downstream of an Ef1a promoter and upstream of a T2A-mScarlet3 fusion (Addgene 189753), and an SV40 terminator ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and codon-optimized mCherry(Dunlop, et al. 2008) coding sequences. The terminators were obtained from pNS2-VL(Dunlop, et al. 2008)(Addgene, Plasmid #26756) and the assembled sequences of the other elements were commercially synthesized (Fasmac Co. ...
-
bioRxiv - Immunology 2024Quote: ... STAT1 cDNA was PCR-amplified from Addgene #8691 (a gift from Jim Darnell (Horvath et al ...
-
bioRxiv - Genetics 2024Quote: ... was combined with the human ACE2 CDS (Addgene #1786) and the three polyadenylation signals (b-globin ...
-
bioRxiv - Genetics 2024Quote: ... cells were infected with lentiviral particles generated using the vector #52961 (AddGene) and selected with 20ug/ml puromycin for 24-48 h ...
-
bioRxiv - Genetics 2024Quote: ... sgRNAs or expression vectors were transfected along with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2024Quote: ... and psPAX2 (Addgene #12260) lentiviral vectors which were into HEK293T packaging cells ...
-
bioRxiv - Genetics 2024Quote: Two sgRNAs targeting the start and end of the rme-2 coding sequence were in vitro transcribed from a SP6 transcription template amplified from pDD162 (Addgene #47549) using primers P42 (start sgRNA ...
-
bioRxiv - Immunology 2024Quote: ... and GFP PCR amplification from plasmid pDSAG (Addgene #62289) respectively ...
-
bioRxiv - Immunology 2024Quote: ... 0.54 μg envelope plasmid pMD2.G (Addgene #12259), and 0.99 μg packaging plasmid psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing luciferase under the control of HBV promoters were purchased from Addgene: preC/C_Luc (pHBV_Luc ...
-
bioRxiv - Genomics 2024Quote: ... 1.9 µg of the transposon (pSBbi-RP, Addgene plasmid #60513) 39 and 100 ng of the transposase (pCMV(CAT)T7-SB100 ...
-
bioRxiv - Genomics 2024Quote: ... the resulting amplicon was Gibson-cloned into BsmBI-digested pLentiRfxGuide-Puro (Addgene 138151). We verified successful cloning via Illumina sequencing to verify high gRNA recovery (>99% ...
-
bioRxiv - Immunology 2024Quote: ... The Lentivirus vector pHIV-iRFP720-E2A-Luc was obtained from Addgene. Lentiviruses carrying pcyt2-RFP720 or RFP720 were packaged using the Lenti-X™ 293T Cell Line ...
-
bioRxiv - Neuroscience 2024Quote: ... mice received either an injection of Cre-dependent control vector (AAV8-hSyn-DIO-mCherry, Addgene, Watertown, MA) or the Cre-dependent Gi/o-coupled DREADD vector (AAV8-hSyn-DIO-hM4d-mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... 250 nL of pENN.AAV9.CaMKII.GCaMP6s.WPRE.SV40 (concentration of 1.0E+12 viral genomes/mL, Addgene, 107790) was injected into the right primary motor cortex to specifically target layer 2&3 neurons ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-FLEX-tdTomato (Addgene, Catalog# 28306-AAV1), pAAV5-hsyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Cre recombinase was expressed from a plasmid derived from pPGK-Cre-bpA (Addgene #11543) with an SV40polyA sequence instead of the bpA ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted in the pTALYM3B15 plasmid (obtained from Addgene #47878) the HIRA-WT and HIRA-W799A-D800A coding sequences.59 using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Feng Zhang (Addgene plasmid no. 62988) followed by transient transfection in wild-type HeLa cells using JetPRIME ...
-
bioRxiv - Cell Biology 2024Quote: PINK1 KO cells were generated using CRISPR-Cas9 with a PINK1 targeting sgRNA (5’-CACCGTACCCAGAAAAGCAAGCCG-3’) cloned into pU6-(BbsI)-CBh-Cas9-T2A-mCherry (Addgene, #64324). This plasmid was transfected into hTERT-RPE1 Flp-In TREX cells followed 24 h later by fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with mCherry-RAB5 Q79L (Addgene #35138 ...
-
bioRxiv - Cell Biology 2024Quote: ... pENTR2B-EPLINα was LR subcloned with a pDEST-V2-ORF (Addgene 73636) according the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Corresponding guide sequence (AGCGACGGGATGGCTGCGGC) was cloned into pXPR_001 lentiCRISPR v1 plasmid (Addgene 49535) cleaved with BsmBI (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... CRISPR guide RNA that targets the region prior to Fkbp8 start codon was designed using CRISPR Design tool (Horizon Discovery Ltd.) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) as previously described.46 The donor oligonucleotides containing the 5’ arm sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... pDestTol2pACryGFP was a gift from Joachim Berger & Peter Currie (Addgene plasmid # 64022). These clones were used along with the following tol2 kit gateway clone ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-AKAR4 was a gift from Jin Zhang (Addgene plasmid # 61619 ...
-
bioRxiv - Cell Biology 2024Quote: ... guide RNA was designed using the CRISPR Design tool (http://crispr.mit.edu/) and subcloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230), a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... cells were transfected with a Myc-tagged LC3 ectopic expression plasmid (pCMV-myc-LC3; #24619, Addgene) using Lipofectamine 3000 transfection reagent (#L300015 ...
-
bioRxiv - Cell Biology 2024Quote: ... the EGFP-Rab7A (a gift from Qing Zhong, Addgene#28047, RRID:Addgene_28047) was cloned into a pRetroQ (Clontech)-based retroviral vector ...
-
bioRxiv - Cell Biology 2024Quote: ... eSpCas9Plus (a gift from Ervin Welker, Addgene# 126767, RRID:Addgene_126767) was cloned into a pLIX-based lentiviral vector ...
-
bioRxiv - Cell Biology 2024Quote: ... pEGFP-Rab4A was a gift from Marci Scidmore (Addgene# 49434, RRID:Addgene_49434). pEGFP-Rab5A and pEGFP-Rab7A were gifts from gift from Guido Serini (Torino University ...
-
bioRxiv - Cell Biology 2024Quote: ... the EGFP-Rab7A (a gift from Qing Zhong, Addgene#28047, RRID:Addgene_28047) was cloned into a pRetroQ (Clontech)-based retroviral vector ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... LAMP1-RFP was a gift from Walther Mothes (Addgene plasmid # 1817)57 ...