Labshake search
Citations for Addgene :
1401 - 1450 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: hES cells (H1) were thawed at P29 and transfected with 3.3µM of each hCas9D10A (Addgene #74495), and a gRNA/donor plasmid (pUC_lmnA_Neo_exn1_donor_fixed containing gRNA sequence GCAGGAGCTCAATGATCGCTTGG ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... we transiently transfected MCF7 and SMMC-7721 cells with the Utrophin-GFP reporter (Plasmid #26737, Addgene) using X-tremeGENE HP DNA Ttransfection Reagent (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Biochemistry 2022Quote: ... these cells were transduced with lentiviral particles for TetO-Fuw empty vector (Addgene plasmid number 85747)(30) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6cm dishes of cells were transfected with 1ug of guide RNA expressing px300 plasmid (#42230, Addgene) and 1ug of each HDR template/NHEJ PCR product ...
-
bioRxiv - Molecular Biology 2020Quote: ... TbC1 cells were reverse transfected with 400ng of U6>sgRNA plasmids (George Church, Addgene plasmid #41824) according to Table S2 and 3μL Lipofectamin 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: Cas9-expressing p185+ B-ALL cells were transduced with the Brie CRISPR KO library (Addgene #73633) at a multiplicity of infection of 0.5 with an sgRNA coverage of 400x (24) ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Neuroscience 2019Quote: ... L cells were transiently transfected with Pi16-tGFP (Origne MG219996) and pm-Turq-ER (Addgene 36204) with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... cells were transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid #102244).
-
bioRxiv - Cancer Biology 2019Quote: ... Then cells were transfected with 100 ng of pTsgRNA-DMP-Cas9-EGFP or pEGFP-C1 (Addgene) using Lipofectamine® 2000 Reagent (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: V6.5 cells were infected with lentiviruses harboring the pHR-SFFV-dCas9-BFP-KRAB vector (Addgene,46911) in which the SFFV promoter was replaced with an Ef1a promoter ...
-
bioRxiv - Molecular Biology 2019Quote: ... K562 cells were transduced with Tet-pLKO-neo (a gift from Dmitri Wiederschain, Addgene plasmid #21916) containing either LSD1- ...
-
bioRxiv - Genomics 2019Quote: Lentiviral vectors were produced by transfection of HEK 293T cells with the envelope (psPAX2, Addgene #12260), packaging (pMD2.G ...
-
bioRxiv - Genomics 2019Quote: ... or NIH3T3 cells transiently transfected with Denr cloned into a FLAG-Venus-pLenti6 vector (Addgene 36948). Cells were grown to confluency in a 15-cm dish ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...
-
bioRxiv - Bioengineering 2020Quote: U2OS cells were cultured and transfected with 100-200 ng of mEmerald-Tomm20 plasmid (Addgene, 54281) directly on the BIO-133 bottomed well plate ...
-
bioRxiv - Bioengineering 2021Quote: CRISPR knockdown cells were generated using the lentiCRISPRv2 system (gift of F. Zheng, Addgene plasmid #52961). Scramble guideRNA (gRNA ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines stably expressing Cas9 were generated by lentiviral infection with pCRISPRV2-FLAG-CAS9 (Addgene #52961) followed by puromycin selection and monoclonal population generation by limiting dilution in 96 well plates ...
-
bioRxiv - Biophysics 2021Quote: ... cells were transfected with transgene plasmid together with lentivirus packaging plasmids psPAX2 (Addgene, Cat. No. 12260) and pMD2.G (AddGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... We enriched RM1-BoM1 cells negative for GFP and transduced with Tdtomato (LeGO-T2, Addgene #27342) and luciferase (pENTR-LUC ...
-
bioRxiv - Microbiology 2020Quote: Huh7.5.1 cells were stably transduced with lentivirus from lentiCas9-Blast (Addgene #52962, gift from Feng Zhang) and subsequently selected using blasticidin ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.G and psPAX2, Addgene) using calcium phosphate transfection method ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral particles were generated by transfecting HEK293T cells with the packaging plasmids pMD2.G (Addgene 12259) and psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Biophysics 2020Quote: ... we stably integrated tdMCP-tdGFP and OsTIR1 into cells using a standard lentiviral production protocol (Addgene). For lentivirus production ...
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2021Quote: ΦNX-ecotropic packaging cells were transfected with pBABE-hygro (Addgene plasmid # 1765; empty or Bcl-XL) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus was generated in HEK293T cells transfected with pMD2.G and psPAX2 (Addgene, 12259 and 12260) and the given pTRIPZ constructs ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated at 50% confluency and transfected the next day with GFP-LC3 (Addgene #21073) or double transfected with GFP-LC3 and one of the FLAG-hSynj1 constructs (see below) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentivirus preparation for stable cell line generation was done with pMD2.G envelope plasmid (Addgene #12259) and psPAX2 packaging plasmid (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 amplified from cDNA obtained from 293T cells and the pINDUCER-21-RUNX1 plasmid (Addgene plasmid #97043 ...
-
bioRxiv - Cell Biology 2022Quote: ... iEC-ESCs and iHUF cells were tagged with Azurite blue using pLV-Azurite (Addgene plasmid 36086). Lentiviral transductions were performed according to manufacturers’ protocols and successfully tagged cells were further sorted on a Beckman Coulter MoFlow Astrios (Indianapolis ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells in each well were transfected with 500ng pCMV-PE2 (Anzalone et al., 2009, Addgene#132775), 330ng pU6-pegRNA and 170ng pBPK1520-ngRNA for PE3 strategy or 500ng pCMV-PE2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviruses were produced in 293T cells with a second-generation packaging system containing psPAX2 (#12260; Addgene) and pMD2.G (#12259 ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293T cells were transfected with pCMV-VSV-G (a gift from Bob Weinberg; Addgene plasmid # 8454) (22) ...
-
bioRxiv - Microbiology 2022Quote: ... This was done by transfection of HEK-293 cells with an optimized T7 plasmid (Addgene 65974) together with the antigenomic plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were then infected with viral particles carrying a catalytically dead Cas9-VP64 (Addgene #61425) and MS2-P65-HSF1 constructs (Addgene #89308) ...
-
bioRxiv - Neuroscience 2020Quote: ... Lentiviral packaging was performed in HEK 293T cells using commercial plasmids (Addgene plasmids 12259 and 12263) and protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6419c5 and 5074 cells were transduced with a lentiviral expression vector of h2b-dendra2 (Addgene #51005). Single cell clones expressing Dendra2-H2B were derived by FACS sorting.
-
bioRxiv - Cancer Biology 2021Quote: ... Parental and BRCA2−/− DLD1 Cas9 cells were generated through viral infection with lentiCas9-Blast (Addgene #52962) followed by blasticidin selection ...
-
bioRxiv - Physiology 2021Quote: ... a biosensor for cAMP in mammalian cells was purchased from Addgene (Harada, Ito et al. 2017) (Cat #102356) ...
-
bioRxiv - Cancer Biology 2022Quote: HEK-293T cells were co-transfected with the pcw107-V5 plasmid expressing CA-STAT3 (Addgene #64611), VSV-G envelope plasmid ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles were produced in HEK293T cells by co-transfecting packaging vector psPAX2 (8µg, Addgene, #12260), envelop vector pMD2.G (4µg ...