Labshake search
Citations for Addgene :
1301 - 1350 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... which was a gift from James Thomson (Addgene plasmid #20922 ...
-
bioRxiv - Biochemistry 2024Quote: ... The cpGFP gene was supplied by the Jin Zhang lab (Addgene 64854) and subcloned into the pET28 vector using the N-terminal 6x-histidine tag followed by a TEV cleavage site(HTSD1.00) ...
-
bioRxiv - Biochemistry 2024Quote: ... HT22 cells were transfected with psPAX2 (Addgene # 12260), and pMD2.G (Addgene # 12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pcDNA3-ATR WT (Addgene) was transfected with 1 μg of plasmid during 48 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene, 12259) using Endofectin (GeneCopoeia ...
-
bioRxiv - Cell Biology 2024Quote: ... the Neo-M2rtTA donor (Addgene #60843) and a pair of TALENs (Addgene # 59025 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pHAGE-ESR1 was purchased from Addgene (116737). To generate pLenti6/V5-HMGCR ...
-
bioRxiv - Neuroscience 2024Quote: ... Olig001 was a gift from Thomas McCown (Addgene plasmid # 170716 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-HA-RIPK3 (78804) and pcDNA3-FLAG-RIPK1 (78842) were procured from Addgene.
-
bioRxiv - Cell Biology 2024Quote: ... by PCR-amplifying the Venus gene from pJP114 (Phillips et al., 2022) and cloning it by Gibson assembly into a KpnI and AflII digest of pJP103 (Addgene #176481), which contains a hygromycin B resistance cassette ...
-
bioRxiv - Cell Biology 2024Quote: ... We then synthesized the NMM motif (sJP203) following the sequence from the pONSY-coNMM:mCherry vector (Addgene #111878, (Parra-Acero et al., 2018)) and cloned this DNA fragment into a KpnI digest of pJP115 using Gibson assembly.
-
bioRxiv - Cell Biology 2024Quote: ... The coHpo transgene was cloned into a KpnI and AflII digest of pJP103 (Addgene #176481) using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid for tagBFP in our lab stock (TRE-NLS-tagBFP, which is modified from Addgene plasmid #92202). The NLS-tagBFP sequence was PCR amplified from plasmid pAAV-TRE-NLS-tagBFP ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Neuroscience 2024Quote: ... pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene plasmid #64324 ...
-
bioRxiv - Neuroscience 2024Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene plasmid #64324 ...
-
bioRxiv - Neuroscience 2024Quote: ... pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene plasmid #64324; http://n2t.net/addgene:64324; RRID:Addgene_64324). Paired sgRNAs targeting regions of CNTN4 and APP were designed to generate homozygous knockout in addition to the non-targeting empty vector control (full sequence detail in Table S1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Co-expression of GCaMP6s and mRuby2 in neocortical and hippocampal neurons was achieved by injecting pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s one week before imaging (Fig. 1A; Addgene, catalog # 50942-AAV1; 1.2×1013 GC/mL). Animals were anesthetized using hypothermia ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors were transfected into HEK293T cells with packaging vector psPAX2 (Addgene #12260) and envelop vector VSV-G using polyethylenimine (PEI 1mg/ml) ...
-
bioRxiv - Cell Biology 2024Quote: ... and pX330S-2-PITCh (Addgene #63670) were combined with guide RNAs (gRNAs ...
-
bioRxiv - Cell Biology 2024Quote: ... donor vector and Kdm3b microhomology arms were cloned into the pCRIS-PITChv2-BSD-dTAG (Addgene #91792) donor vector to allow for dual selection with puromycin and blasticidin S hydrochloride.
-
bioRxiv - Cell Biology 2024Quote: ... pX330A-1x2 (Addgene #58766) and pX330S-2-PITCh (Addgene #63670 ...
-
bioRxiv - Cell Biology 2024Quote: ... which were inserted into dual gRNA targeting vector pX333 (Addgene #64073). E14 ESCs were then transfected with 0.5µg of the targeting vector using Lipofectamine 3000 (Thermo Fisher Scientific-L3000001) ...
-
bioRxiv - Cell Biology 2024Quote: ... pH2B-mNG211 (Addgene #206043) was generated by amplifying the H2B gene from an H2B-mRuby plasmid (Beaudet et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... The left and right homology arms for the AAVS1 locus and the puromycin gene were amplified individually from the pAAVS1-P-CAG-GFP plasmid (Addgene #80491; Oceguera-Yanez et al., 2016). These fragments were cloned into the pYTK089 backbone by Golden Gate using a standard protocol (Lee et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Kdm3a microhomology arms were added to the pCRIS-PITChv2-Puro-dTAG (Addgene #91793) donor vector and Kdm3b microhomology arms were cloned into the pCRIS-PITChv2-BSD-dTAG (Addgene #91792 ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene, MA, USA, #12263) and pCMV-VsVg (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... eGFP-BICD1 (Addgene #49487 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... MegaGate was utilized to insert ORFs into the final PB-cT2G-cERP2 3’ UTR barcode-modified expression vectors (Addgene 175503). Three unique barcodes were selected for each ORF with an average hamming distance of six ...
-
bioRxiv - Developmental Biology 2024Quote: ... the dCas9-KRAB-meCP2 repressor (Addgene 110821)55 was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 μg of episomal pCXLE-Sox2A61V-2A-Klf4-2A-Myc (Addgene #210017) and 3 μg of pCXWB-EBNA1 (Addgene #37624 ...
-
bioRxiv - Cell Biology 2024Quote: ... U2OS cells were co-transfected with pLentiCRISPRv266 (Addgene plasmid # 52961 ; RRID:Addgene_52961) expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Cell Biology 2024Quote: ... U2OS cells were co-transfected with pLentiCRISPRv266 (Addgene plasmid # 52961 ; RRID:Addgene_52961) expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA ...
-
bioRxiv - Developmental Biology 2024Quote: ... was PCR amplified from pJW2171 (Addgene plasmid #163095) and concentrated using a PCR purification kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2024Quote: Both pWZ186 (Addgene plasmid #163641) and a plasmid containing 2xmTurquoise2 were double digested with Bsu36I and NgoMIV to excise 2xmKate2 and 2xmTurquoise2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA fragments for the open reading frame of the mCherry protein and the backbone plasmid were amplified using the pENTR R4-mCherry-R3 plasmid (Addgene #32311) as a template ...
-
bioRxiv - Developmental Biology 2024Quote: ... into the T444T vector (Addgene plasmid #113081) using the BglII and XhoI restriction sites (Sturm et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Cell Biology 2024Quote: LifeAct-mEmerald (no. 54148) and GCaMP6s (no. 40753) were obtained from Addgene (Watertown, MA). Eevee-ROCK was kindly provided by Dr ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.g (Addgene #12259) using CalPhosTM mammalian transfection kit (Clontech #631312 ...