Labshake search

9901 - 9950 of 10000+ citations since 2019

• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... using genome plasmids pRVΔG-4Flpo (Addgene 122050) and pRVΔG-4Cre (Addgene 98034).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: The piggyBac plasmid pB-CAG-B19L-IRES-mCherry-WPRE-BGHpA (Addgene 178518) was made by cloning the CAG promoter from pCAG-B19G (Addgene 59921) ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: pCAG-hypBase was made by synthesizing a fragment encoding the “hyperactive” piggyBac transposase iPB777 and cloning into the EcoRI & NotI sites of pCAG-GFP78 (Addgene 11150).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: pAAV-syn-Flpo (Addgene 174378) and pAAV-syn-mCre (Addgene 178515 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: Lentiviral vectors were made as described87 but with the VSVG expression vector pMD2.G (Addgene 12259) as the envelope plasmid and with the following transfer vectors:
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... were made by replacing the CMV promoter and EGFP gene in pCSC-SP-PW-GFP (Addgene 12337) with the leaky tetracycline response element from pAAV-FLEX-hGTB (Addgene 26196 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... and the woodchuck post-transcriptional regulatory element and bovine growth hormone polyadenylation signal from pCSC-SP-PW-GFP (Addgene 12337), into PB-CMV-MCS-EF1-Puro (System Biosciences #PB510B-1).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... was made by cloning the CAG promoter from pCAG-B19G (Addgene 59921), the SAD B19 L gene ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: AAV genome plasmids pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene 100798) and pAAV-TREtight-mTagBFP2-B19G (Addgene 100799 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... followed by the jGCaMP7s75 gene from pGP-CMV-jGCaMP7s (Addgene 104463).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: pLV-U-TVA950 (Addgene 115236), to make the TVA-expressing lentiviral vector LV-U-TVA950(VSVG).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... was made similarly but with the tricistronic open reading frame from pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene 100798) except for the use of FRT sites instead of lox ones (and with a 2-bp frameshift of the in-frame FRT site to prevent creation of a premature stop codon) ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... to make the Flp-in construct “TRE-mCardinal-P2A-B19L Flp-in vector” (Addgene # 178519). The lox-stop-lox sequence present in the original Flp-in vector was removed to make the new construct ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: pAAV-syn-F14F15S-splitTVA-EGFP-tTA_v2 (Addgene 183352) was made similarly but with the tricistronic open reading frame from pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene 100798 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... was made by cloning a codon-optimized tet transactivator gene76 into pAAV-synP-FLEX-EGFP-B19G (Addgene 59333).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... into “Ai62(TITL-tdT) Flp-in replacement vector” (Addgene 61576), to make the Flp-in construct “TRE-mCardinal-P2A-B19L Flp-in vector” (Addgene # 178519) ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... and pRVΔGL-4Cre (Addgene 98039). Supernatants from rescue plates were passaged on 15 cm plates of HEK 293T/17 cells (ATCC ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... and pRVΔG-4Cre (Addgene 98034).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... and pAAV-TREtight-mTagBFP2-B19G (Addgene 100799) have been described previously38 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... were made by replacing the FLEX cassette from pAAV-synP-FLEX-EGFP-B19G (Addgene 59333) with mouse-codon-optimized genes for Flp57 and Cre55.
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: pAAV-syn-F14F15S-jGCaMP7s (Addgene 178514) was made by cloning a Flp-dependent FLEX arrangement of mutually-incompatible FRT sites74 into pAAV-synP-FLEX-EGFP-B19G (Addgene 59333 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... was made by cloning a Flp-dependent FLEX arrangement of mutually-incompatible FRT sites74 into pAAV-synP-FLEX-EGFP-B19G (Addgene 59333) followed by the jGCaMP7s75 gene from pGP-CMV-jGCaMP7s (Addgene 104463).
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... with the leaky tetracycline response element from pAAV-FLEX-hGTB (Addgene 26196) followed by a tricistronic open reading frame consisting of the genes for the “improved tetracycline transactivator” itTA82 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: The “TLoop”-style81 lentiviral transfer vectors pLV-TTBG (Addgene 115232) and pLV-TTBL (Addgene 115233 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... and pLV-TTBL (Addgene 115233) were made by replacing the CMV promoter and EGFP gene in pCSC-SP-PW-GFP (Addgene 12337 ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... AAVs from Addgene were initially thawed and aliquoted in 20x 5ul aliquots ...
• Long-term labeling and imaging of synaptically-connected neuronal networks in vivo using double-deletion-mutant rabies viruses

  Lei Jin, et al., bioRxiv - Neuroscience 2023

  Quote: ... The two helper AAVs from Addgene were diluted in Dulbecco’s phosphate-buffered saline (DPBS ...
• α-Synuclein Aggregation is Triggered by Amyloid-β Oligomers via Heterogeneous Primary Nucleation

  Devkee M. Vadukul, et al., bioRxiv - Biochemistry 2023

  Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
• Piezo1-mediated spontaneous activity of satellite glia impacts DRG development

  Jacob P. Brandt, Cody J. Smith, bioRxiv - Developmental Biology 2023

  Quote: ... pME-cas9mkate (Addgene 109547), and p3E-pA constructs into a pDestTol2CG2 containing a U6 promoter sequence flanked with BseRI cleavage sites.[50,64] Following recombination the resulting plasmid ...
• Piezo1-mediated spontaneous activity of satellite glia impacts DRG development

  Jacob P. Brandt, Cody J. Smith, bioRxiv - Developmental Biology 2023

  Quote: ... we injected a uas:Chr2-tdTomato (Addgene 124237) into animals expressing Tg(sox10:gal4) ...
• Arousal and locomotion differently modulate activity of somatostatin neurons across cortex

  Christine F. Khoury, et al., bioRxiv - Neuroscience 2023

  Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
• YAP controls cell migration and invasion through a Rho-GTPase switch

  Sagar R. Shah, et al., bioRxiv - Cancer Biology 2023

  Quote: The YAP constitutively active overexpression lentiviral vector was generated using pCMV-Flag YAP127/128/131/381A plasmid (Addgene) and Duet011 lentiviral plasmid.
• Type I interferon shapes brain distribution and tropism of tick-borne flavivirus

  Nunya Chotiwan, et al., bioRxiv - Microbiology 2023

  Quote: ... and the neomycin gene sequence from pMC1neo (Addgene https://www.addgene.org/vector-database/3549/ ...
• The Alzheimer’s disease risk gene BIN1 modulates neural network activity via the regulation of L-type calcium channel expression in human-induced neurons

  Orthis Saha, et al., bioRxiv - Neuroscience 2023

  Quote: ... The lentiviral constructs used were TTA (Vect’UB; ID # 571) and TetO-Ascl1-Puro (Addgene, # 97329). Lentiviral infections were done in NPCs at P3 or P4 ...
• RecA levels modulate biofilm development in Acinetobacter baumannii

  Carly Ching, et al., bioRxiv - Microbiology 2023

  Quote: ... this plasmid was used in a Golden Gate reaction using pMB1-B (Addgene number 190115) and BsaI-HF (NEB ...
• RecA levels modulate biofilm development in Acinetobacter baumannii

  Carly Ching, et al., bioRxiv - Microbiology 2023

  Quote: ... The plasmid pBP_lacZ (Table S1; Addgene accession number 72948) and the purified PCR fragment were digested using SphI and NdeI ...
• RecA levels modulate biofilm development in Acinetobacter baumannii

  Carly Ching, et al., bioRxiv - Microbiology 2023

  Quote: ... as restriction and pBP_sgRNA (Addgene number: 190128) as the target vector ...
• RecA levels modulate biofilm development in Acinetobacter baumannii

  Carly Ching, et al., bioRxiv - Microbiology 2023

  Quote: ... pMB1-B-recA was recombined with pMB1-A-pBAD-dCas9 (Addgene number: 190132) in the target plasmid pMB2a-tet (a modified version of Addgene number ...
• RecA levels modulate biofilm development in Acinetobacter baumannii

  Carly Ching, et al., bioRxiv - Microbiology 2023

  Quote: ... ligated into the pET-His6-TEV-LIC vector (plasmid 29653; Addgene, Cambridge, MA, USA) using the Ligation Independent Cloning Protocol (Gradia et al. ...
• Sex-Specific Effects of Psychedelic Drug Exposure on Central Amygdala Reactivity and Behavioral Responding

  DP Effinger, et al., bioRxiv - Neuroscience 2023

  Quote: ... Bilateral infusions of pGP-AAV-syn-jGCaMP7f-WPRE (Addgene plasmid# 104488-AAV9) were performed at a rate of 100nl/minute into the CeA (AP:-2.0mm ...
• Unidirectional protein recruitment is essential for viral latency

  Ido Lavi, et al., bioRxiv - Microbiology 2023

  Quote: ... and pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene plasmid # 60907 ...
• Unidirectional protein recruitment is essential for viral latency

  Ido Lavi, et al., bioRxiv - Microbiology 2023

  Quote: pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene plasmid # 60903 ...
• Unidirectional protein recruitment is essential for viral latency

  Ido Lavi, et al., bioRxiv - Microbiology 2023

  Quote: ... a gift from David Root (Addgene plasmid # 41395 ...
• Unidirectional protein recruitment is essential for viral latency

  Ido Lavi, et al., bioRxiv - Microbiology 2023

  Quote: ... a gift from Izuho Hatada (Addgene plasmid # 82560 ...
• Unidirectional protein recruitment is essential for viral latency

  Ido Lavi, et al., bioRxiv - Microbiology 2023

  Quote: ... pgRNA-humanized was a gift from Stanley Qi (Addgene plasmid # 44248; http://n2t.net/addgene:44248; RRID:Addgene_44248) 29 ...
• The formation and closure of macropinocytic cups in a model system

  Judith E. Lutton, et al., bioRxiv - Cell Biology 2023

  Quote: ... Cells were transformed by electroporation and selected on pre-grown bacteria with the appropriate drug 48 (Table S2; most plasmids are available from Addgene).
• Regulation of Store-Operated Ca²⁺ Entry by IP₃ Receptors Independent of Their Ability to Release Ca²⁺

  Pragnya Chakraborty, et al., bioRxiv - Cell Biology 2023

  Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
• In vivo seamless genetic engineering via CRISPR-triggered single-strand annealing

  Gustavo Aguilar, et al., bioRxiv - Genetics 2023

  Quote: gRNAs were cloned into pCFD5 (Addgene 73914) by BbsI digestion and Gibson Assembly as previously described (Port & Bullock ...
• In vivo seamless genetic engineering via CRISPR-triggered single-strand annealing

  Gustavo Aguilar, et al., bioRxiv - Genetics 2023

  Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...