Labshake search
Citations for Addgene :
9501 - 9550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pRSV-REV (Addgene 12253), and pMD2g (Addgene 12259) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transformants were obtained by co-injecting this plasmid with a pCFD3-dU6:3gRNA plasmid (Addgene #49410) expressing the gRNA GACGCATTTATGGATGCGGG and screening for 3xPax3dsRED ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloning into pCAGEN (Addgene 11160) with XhoI (NEB R0146 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The pB6-ROSA26-DTA-Soriano-for vector was a gift from Mario Capecchi (Addgene plasmid # 125745 ; http://n2t.net/addgene:125745 ; RRID:Addgene_125745).
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G (Addgene 12259) and various transfer vectors described hereafter (https://www.addgene.org/guides/lentivirus/).
-
bioRxiv - Cell Biology 2023Quote: ... and the pcDNA3.1 MCS-BirA(R118G)-HA was a gift from Kyle Roux (Addgene plasmid # 36047 ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-Sec61β fusion was subcloned from mCh-Sec61β (Addgene, 49155) into the lentiviral plasmid FCW2IB-Lifeact-mWasabi 42 by replacing the LifeAct-mWasabi fusion ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 119), into the pcDNA3.3 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted into empty pCW57.1 (Addgene plasmid #41393) using the NheI and BamHI restriction enzyme (RE ...
-
bioRxiv - Cell Biology 2023Quote: ... 3xHA-TurboID was amplified from 3xHA-TurboID-NLS pcDNA3 (Addgene plasmid #107171) and inserted into empty pCW57.1 (Addgene plasmid #41393 ...
-
bioRxiv - Cancer Biology 2023Quote: MM1S and KMS18 cells were first virally transduced with LentiCas9-Blast (Addgene #52962) and Cas9 expression was confirmed by Western Blot (Cell Signaling Technology #14697) ...
-
bioRxiv - Immunology 2023Quote: ... and psPAX2 (Addgene #12260) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... pMD2.G (Addgene #12259), and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2023Quote: ... and pNJP (Addgene plasmid # 115494 ...
-
bioRxiv - Developmental Biology 2023Quote: NPCs were transfected with a FLAG-YAP1 plasmid (Addgene #27371, (Cappello et al., 2013)) and a control plasmid (pEGFP-C1 plasmid ...
-
bioRxiv - Immunology 2023Quote: ... TThis fragment then was subcloned into a retroviral SFG.CNb30_opt.IRES.eGFP (Addgene, USA) at the NcoI and XhoI restriction sites ...
-
bioRxiv - Microbiology 2023Quote: LentiCRISPRv2 plasmids (52961, Addgene) targeting Zcchc3 gene were generated as follows ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Developmental Biology 2023Quote: ... from two control NPC lines and two patient NPC lines were transfected with the plasmid pCMV-Sport6-CD63-pHluorin (A gift from DM Pegtel (Addgene plasmid # 130901 ...
-
bioRxiv - Developmental Biology 2023Quote: ... from two control NPC lines and two patient NPC lines were transfected with the plasmid pCMV-Sport6-CD63-pHluorin (A gift from DM Pegtel (Addgene plasmid # 130901 ; http://n2t.net/addgene:130901 ; RRID:Addgene_130901) using the Lipofectamine™ 3000 Transfection Reagent (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... pMD2.G and psPAX2 was a gift from Didier Trono (Addgene plasmid #12259 and #12260 ...
-
bioRxiv - Immunology 2023Quote: ... The pLL3.7 plasmid was a gift from Luk Parijs (Addgene plasmid #11795)35 ...
-
bioRxiv - Cell Biology 2023Quote: ... They were then cloned into a pCCC vector which is based on pSpCas9(BB)-2A-GFP vector (PX458, Addgene plasmid # 48138). The pCCC vector contains the complete U6 promoter for enhanced expression in hiPSCs ...
-
bioRxiv - Cell Biology 2023Quote: ... pCMV CEPIA2mt (Addgene plasmid # 58218) plasmid (1.5 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lentiviral plasmid (pLVSIN-PIP-FUCCI or pBOB-EF1-FastFUCCI (Addgene; plasmid # 86849), which was a gift from Kevin Brindle & Duncan Jodrell) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Isoform 3 constructs were cloned into a pMSCV puro backbone (Addgene) and packaged into retrovirus using Phoenix-AMPHO producer cells (ATCC) ...
-
bioRxiv - Immunology 2023Quote: ... The LentiCas9-Blast plasmid (Addgene plasmid #52962) was first expressed in EJ cells via lentiviral transduction ...
-
bioRxiv - Biochemistry 2023Quote: The GFP-UBR5 plasmid was a gift from Darren Saunders (Addgene plasmid #52050 ;http://n2t.net/addgene:52050 ...
-
bioRxiv - Biochemistry 2023Quote: The GFP-UBR5 plasmid was a gift from Darren Saunders (Addgene plasmid #52050 ;http://n2t.net/addgene:52050 ; RRID:Addgene_52050) 75 and was recloned into a pEG-vector to enable its recombinant expression in HEK293 suspension cells using the BacMam-system ...
-
bioRxiv - Biochemistry 2023Quote: ... pME-NR2F2 was a gift from Nathan Lawson (Addgene plasmid #138359; http://n2t.net/addgene:138359; RRID:Addgene_138359). pcDNA Myc DBC1 was a gift from Osamu Hiraike (Addgene plasmid # 35096 http://n2t.net/addgene:35096 ...
-
bioRxiv - Biochemistry 2023Quote: ... pIRE4-Azi was a kind gift from Irene Coin (Addgene plasmid #105829 ...
-
bioRxiv - Bioengineering 2023Quote: ... pET-28a (+) vector was obtained as a gift from Hermann Gaub (Addgene plasmid # 90473 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 15μg serotype plasmid (pUCmini-iCAP-PHP.eB, a gift from Viviana Gradinaru 101, Addgene plasmid #103005). Three days following transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used pLKO-Tet-On-shRNA-Control plasmid (98398, Addgene). dCasRx-FTOWT-HA plasmid was received as a generous gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate DOX inducible METTL3-KD cells in ALT+ NB METTL3- sh1 sequences were cloned in the Tet-pLKO-puro vector (21915, Addgene). As a control for inducible shRNA KD ...
-
bioRxiv - Cancer Biology 2023Quote: ... Active CasRx was obtained from Addgene (138149). The TERRA and non-template control (NTC ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TERRA and non-template control (NTC) gRNAs were cloned in pLentiRNAGuide_002 (138151, Addgene). Sequences of guide RNAs are provided in Supplementary Table S1 ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: The constructs for pRK5-HA-Ubiquitin-WT (Addgene plasmid #17608), pRK5-HA-Ubiquitin-KO (Addgene plasmid #17603 ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... pRK5-HA-Ubiquitin-KO (Addgene plasmid #17603) and pRK5-HA-Ubiquitin-K48 (Addgene plasmid #17605 ...
-
bioRxiv - Biochemistry 2023Quote: ... The HsMCUb sgRNAs were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid (72) ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Biochemistry 2023Quote: ... The Myc-tagged strains were then transformed with pRS319 (RRID:Addgene_35459, ref. (79)) to introduce a LEU3 marker for selection ...
-
bioRxiv - Biochemistry 2023Quote: ... was mixed with packaging plasmids MD2G (1 μg, Addgene 12,259) and PSPAX2 (1 μg ...
-
bioRxiv - Bioengineering 2023Quote: ... and fluorescent HMEC1s were created by introducing mCherry (pCDH-CMV-mCherry-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72264 ...
-
bioRxiv - Bioengineering 2023Quote: ... with plasmids for viral packaging (psPAX2 was a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260), viral envelope (pMD2.G was a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pmCherry Paxillin (#50526) and pLL3.7 EGFPC2 TAZ was a gift from Yutaka Hata (Addgene plasmid # 66850). Lifeact-mCherry-N1 and mCherry-Paxillin were amplified by PCR and cloned into pLenti-blasticidin (kindly provided by Dr ...
-
bioRxiv - Bioengineering 2023Quote: ... each well received the following plasmids: ZipGFP-Casp3 plasmid (Addgene plasmid #81241) and pcDNA3-PpC_TRIM8_# ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5 μg pMD2.G (Addgene #12259), 1.5 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Bioengineering 2023Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene plasmid # 43803) were a gift from George Church and were used as the backbone plasmids for all studies (25) ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...