Labshake search
Citations for Addgene :
9451 - 9500 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... following instructions from Addgene. Cells were then subjected to aseptic sorting for selecting double-infected cells (expressing mVenus and mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... a gift from Steve Jackson (Addgene plasmid #74119). The donor DNA template for homology-directed repair (HDR ...
-
bioRxiv - Cell Biology 2023Quote: ... a gift from Ron Vale (Addgene plasmid #67930), and inserted into pBI-CMV1-mCherry (TRIPS-Δ ...
-
bioRxiv - Cell Biology 2023Quote: ... An expression vector for dominant negative KASH (DN-KASH)-mCherry fusion protein was a gift from Daniel Conway (Virginia Commonwealth University, Addgene plasmid #125553) [56] ...
-
bioRxiv - Cancer Biology 2023Quote: ... the attb-containing part of pX28 plasmid backbone (#46850, Addgene) was PCR amplified ...
-
bioRxiv - Cancer Biology 2023Quote: The murine ID8-gTRP53-gBRCA1-Cas9 cell line was generated by co-transfecting a lentiviral Cas9-Blast vector (Addgene #52962) with the packaging plasmids pCMV-dR8.91 and pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the packaging plasmids pCMV-dR8.91 and pCMV-VSV-G (Addgene #8454) into HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV; RRID: Addgene_17446)] at a multiplicity of infection of 10 with 8 μg/mL polybrene (hexadimethrine bromide [Cat # 107689 ...
-
bioRxiv - Cell Biology 2023Quote: ... the strain expressing Hfl1-NG was produced from strain Y1508 by introducing a DNA fragment obtained by PCR using plasmid pFA6a-link-ymNeongreen-SpHis5 (Addgene, #125704) and oligonucleotides #1706 ...
-
bioRxiv - Cell Biology 2023Quote: Vectors for this reporter assay were constructed using a lentiviral construct containing CMV-DsRed and UBC-EGFP on a pHAGE backbone purchased from Addgene (plasmid #24526). This lentiviral construct then underwent site directed mutagenesis using the Agilent QuikChange II kit ...
-
bioRxiv - Cell Biology 2023Quote: ... a sequence encoding the tdTomato fluorescent protein was amplified from a pBa-KIF5C 559-tdTomato-FKBP plasmid (Addgene, Cat. #64211) and inserted into the linearized FHUGW-CRE-DD-zsGreen plasmid by In-Fusion cloning.
-
bioRxiv - Cell Biology 2023Quote: ... and ligation into BsmBI-digested lentiCRISPRv2 as described previously.61,62 The parental vector for CRISPRi gRNA expression under a U6 promoter (pU6-gRNA-EF1alpha-puro-T2A-BFP) was a gift from Jonathan Weissman (Addgene, Cat. #60955).63,64 gRNAs were cloned by annealing complementary oligonucleotides purchased from IDT (Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-Sec61β and mCherry-Sec61β were acquired from Addgene (plasmids 54249 and 49155 ...
-
bioRxiv - Cell Biology 2023Quote: ... with the murine U6 promotor controlled sgRNA expression cassette from pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid # 48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSpCas9 (Addgene; 48137) via Lipofectamine 2000 in the well of a 6-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... The respective products were cloned into pEF5/FRT-DEST (gift from Rajat Rohatgi, Addgene plasmid # 41008) using SpeI and PspXI restriction sites.
-
bioRxiv - Cell Biology 2023Quote: ... Guide RNAs (gRNA1: CACCGCCAGGCTCCAACTGCTGTTC; gRNA2: CACCGATGGCTGCCGGAACAGCAGT; gRNA3: CACCGCTGTGGCCTCCGCCCTAGGT) were selected and cloned into the pSpCas9(BB)-2A-GFP plasmid (Addgene plasmid #48138). BU3 NG iPSCs were pretreated with ROCK Inhibitor (Y-27632 ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA-containing plentiCRISPRv2 plasmids were co-transfected with psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-LoxP-DsRed-LoxP-GFP was amplified from pLV-CMV-LoxP-DsRed-LoxP-GFP (Addgene #65726) (Zomer et al. ...
-
bioRxiv - Cell Biology 2023Quote: pCS2-aTub-Cre2 and I-sceI-Tub-Cre2: The CMV promoter of pCS.Cre2 (Addgene #31308) (Ryffel et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Bob Weinberg (Addgene plasmid #8454 and #8455).
-
bioRxiv - Cell Biology 2023Quote: ... organoids were electroporated with CRISPR-concatamer vectors containing gene-specific guide RNAs (gRNAs) in combination with a Cas9 expression plasmid (Addgene #41815), at a 1:1 ratio ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... untransfected HEK293T cells or cells transfected 48 hours earlier with pEGFP-C1 Lifeact-EGFP (Addgene, plasmid #58470) were treated with Wnt5a CM or protein (200 ng/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 32 ng total/embryo of pCSKA-xwnt8 (Addgene # 16866) plasmid DNA was injected into the 2 dorsal blastomeres of 4-cell stage embryos ...
-
bioRxiv - Cell Biology 2023Quote: ... a plasmid was cloned via T4 ligase using annealed oligos for the paired gRNA sequences and pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) plasmid (Addgene; 42335) cut with BbsI restriction enzyme ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned individually into the pCAG-SpCas9-GFP-U6-gRNA plasmid (Addgene plasmid #79144), and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) (49) ...
-
bioRxiv - Cell Biology 2023Quote: ... the second generation viral packaging plasmids psPax2 (Plasmid #12260) and pMD2.G (Plasmid #12259) were purchased from Addgene. To generate viral particles containing the DNA for a desired construct ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were cloned into the lentiGuide-Hygro-mTagBFP2 vector (Addgene #99374) as previously described101 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the KRAB-MECP2 sequence from the transient expression vector of dCas9-KRAB-MECP2 (for CRISPRi, Addgene #110821)100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we replaced the VP64-P65-Rta sequence (encoding transcription activator complex) in the lentiviral vector of dCas9-VPR-mCherry fusion protein (for CRISPRa, Addgene #102245) with the KRAB-MECP2 sequence from the transient expression vector of dCas9-KRAB-MECP2 (for CRISPRi ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty vector (pBABE-puro) were purchased from Addgene. The wild type and mutant constructs were confirmed by sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... third-generation EGFP transfer plasmid pHAGE-CMV-EGFP-W (EvNO00061634, Harvard Plasmid Repository) was mixed with viral envelope plasmid pMD2.G (12259, Addgene, Watertown, MA) and viral packaging plasmid psPAX2 (12260 ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Biophysics 2023Quote: ... was cloned into the pHR-CMV-TetO2 vector50 (Addgene plasmid #113893). For functional studies the following single or double point mutations were introduced ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371; http://n2t.net/addgene:141371; RRID:Addgene_141371)72 ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370; http://n2t.net/addgene:141370 ; RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro ...
-
bioRxiv - Biophysics 2023Quote: ... LentiCas9-Blast (Addgene 52962) and lentiGuide-Puro (Addgene 52963) ...
-
bioRxiv - Biophysics 2023Quote: ... and lentiGuide-Puro (Addgene 52963), for CRISPR/Cas-mediated genome editing were a gift from Dr ...
-
bioRxiv - Biophysics 2023Quote: ... and its variants were cloned into the pEG-BacMam expression vector with GFP and 8X-His tags at the N-terminus (Addgene, see Table S2). For FLAG-tagged KRAS expression constructs ...
-
bioRxiv - Biophysics 2023Quote: ... was cloned into the pEG-BacMam expression vector with the GFP and 8X-His tags at the C-terminus (Addgene: Table S2). All constructs with large domain insertions and deletions were made using standard protocols for Gibson assembly (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral supernatants were by transient co-transfection of individual constructs with packaging plasmids (psPAX2, Addgene #12260 and pMD2.G ...
-
bioRxiv - Cancer Biology 2023Quote: ... The tdTomato-luciferase plasmid was generated by recombineering using the following pMuLE system plasmids from Addgene: pMuLE ENTR U6-miR-30 L1-R5 (#62113) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mCherry-luciferase plasmid (pCDH-EF-eFFly-T2A-mCherry; Addgene #104833) was used to generate lentiviral supernatants that were transduced into the indicated cell lines followed by FACS sorting of mCherry-high fraction ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral supernatants were by transient co-transfection of individual constructs with packaging plasmids (psPAX2, Addgene #12260 and pMD2.G, Addgene #12259 into HEK-293T cells using X-tremeGENE HP DNA transfection reagent (#06366236001 ...