Labshake search
Citations for Addgene :
9601 - 9650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... AAV-F60,86 is an engineered AAV9-based capsid in pAR9 (rep/cap) (Addgene plasmid 166921). AAV production was performed as previously described60 ...
-
bioRxiv - Genetics 2023Quote: ... which was kindly donated by Ray Owens (Addgene plasmid #53534 ...
-
bioRxiv - Genetics 2023Quote: ... which was kindly donated by Ray Owens (Addgene plasmid #53534; http://n2t.net/addgene:53534; RRID:Addgene_53534). Microinjections were performed with 4-5 µg/µl (diluted in nuclease free water ...
-
bioRxiv - Genetics 2023Quote: ... and used to replace the monomeric streptavidin (mSA) coding sequence of the PCS2+ Cas9-mSA plasmid (Addgene 103882) (Gu et al. ...
-
bioRxiv - Genetics 2023Quote: ... and the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897, kind gift from Dr. Peter Varnai) (Tóth et al. ...
-
bioRxiv - Genetics 2023Quote: ... This was done by appending guide RNA sequences to tracrRNA core and tRNA sequences from pMGC (Addgene, Plasmid #112812) through tailed primers (Table S3 ...
-
bioRxiv - Genetics 2023Quote: ... was inserted into the pMK1200 vector (pMK1200 was a gift from Martin Kampmann & Jonathan Weissman (Addgene plasmid # 84219; http://n2t.net/addgene:84219; RRID: Addgene_84219)) ...
-
bioRxiv - Genetics 2023Quote: ... a PCR fragment was made by amplifying either HphMX (rad1Δ) or NatMX (rad51Δ and pol32Δ) from pAG32 (Addgene plasmid # 35122) or pAG25 (Addgene plasmid # 35121) ...
-
bioRxiv - Genetics 2023Quote: ... a version of pCAS (Addgene plasmid # 60847) 74 in which the gRNA cloning sequences were replaced with an XbaI and ZraI fragment was kindly provided by R ...
-
bioRxiv - Genetics 2023Quote: A version of pCAS (Addgene plasmid # 60847) 74 in which the gRNA cloning sequences were replaced with an XbaI and ZraI fragment was kindly provided by R ...
-
bioRxiv - Genetics 2023Quote: pAA1 was made by cloning the GAL1 promoter into pML107 (Addgene plasmid # 67639)75 ...
-
bioRxiv - Genetics 2023Quote: ... inverse PCR was used to first delete PGK-PuroR and create a linearized vector with terminal ends sharing homology with EF1α-BSD amplified from lentiCas9-Blast vector (Addgene 52962). In vivo assembly (IVA ...
-
bioRxiv - Genetics 2023Quote: ... The mPGK-PuroR-bGHpA fragment was isolated from p2attPC (Addgene 51547) with the mCherry deleted by PCR ...
-
bioRxiv - Genetics 2023Quote: ... Expression plasmids for human U6 promoter-driven sgRNAs were generated by annealing and ligating duplexed oligonucleotides corresponding to spacer sequences into BsmBI-digested pUC19-U6-BsmBI_cassette-SpCas9_sgRNA (BPK1520; Addgene plasmid 65777). Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Genetics 2023Quote: ... Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Genetics 2023Quote: ... or pAG25 (Addgene plasmid # 35121), respectively 73 ...
-
bioRxiv - Genetics 2023Quote: ... DNA plasmids used for transgene cloning were lenti-EF1α-dCas9-VPR-Puro (Addgene 99373) (24 ...
-
bioRxiv - Genetics 2023Quote: ... pZT-C13-L1 (Addgene 62196), pZT-C13-R1 (Addgene 62197 ...
-
bioRxiv - Genetics 2023Quote: ... pZT-C13-R1 (Addgene 62197) (23) ...
-
bioRxiv - Genetics 2023Quote: ... and IGI-P0492 pHR-dCas9-NLS-VPR-mCherry (Addgene 102245). To generate plasmid DNA repair template for expression of dCas9-VPR driven by a constitutive CAG promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... was obtained from Addgene (#40276) (Mülleder et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pUbC-OsTIR1-myc-IRES-scFV-sfGFP (Addgene plasmid # 84563) and pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Addgene plasmid # 84561 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Addgene plasmid # 84561) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional plasmids were obtained from Addgene: pUbC-OsTIR1-myc-IRES-scFV-sfGFP (Addgene plasmid # 84563 ...
-
bioRxiv - Cell Biology 2023Quote: ... (pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230). sgRNA oligonucleotides were ordered from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G (Addgene#12259) and psPAX2 (Addgene#12260 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids (pLenti Lifeact-mRuby2 BlastR, pLentiRhoA2G, tetO-FUW-EGFP-RhoA-Q63L, tetO-FUW-EGFP-RhoA-T19N) were purchased from Addgene. psPAX2 and pMD2.G were generously given by Fa-Xing Yu (Fudan University) ...
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-2xFLAG-SREBP1c (#26802, Addgene) and pcDNA3.1-2xFLAG-SREBP-2 (#26807 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTurquoise2-2xFKBP’-Rac1Q61LΔCAAX was generated by ligating the larger fragment from EGFP-2xFKBP’-Rac1Q61LΔCAAX (Liu et al., 2014) with the smaller fragment from pmTurquoise2-N1 (Addgene Plasmid #60561), after digestion with BsrGI and NheI ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-NMHCIIA (Dulyaninova et al., 2007) was obtained from Addgene (Plasmid #35687). The majority of transfections were performed using Lipofectamine™2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... The control construct delCMV-mCitrine was generated by ligating the larger fragment from pmCitrine-N1 (Addgene Plasmid #54594) with the smaller fragment from the delCMV-mCitrine-RBD biosensor (Graessl et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... In a second step, this resulting plasmid and a PCR fragment amplified from pmTurquoise2-NES (Goedhart et al., 2012) (Addgene Plasmid# 36206) with primers 5’-TCAGTTGCTAGCCTCAAGCTTCGAATTCTG-3’ and 5’-AGAGTCAGCTCGAGATATCTTGTACGAGTCCAG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-C1-Ub was generated from pUB-GFP (Addgene plasmid #11155) by inserting mCherry amplified from mCherry-C1 (Clontech ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The guide RNAs (GTAGCTGCTACTAGCAGACT and TCGTTACTCCCCAGAGTTGA) were cloned into pCFD4 (Addgene plasmid 49411)57 and the 1kb regions upstream and downstream of the cut sites were cloned into vector pHD-attP-DsRed (Addgene plasmid 51019)58 ...
-
bioRxiv - Genetics 2023Quote: ... a total of 13.6 μg core enhancer perturbation library plasmids with 5.44 μg lentiviral packaging vector psPAX2 and 1.36 μg vesicular stomatitis virus G (VSV-G) envelope expressing plasmid pMD2.G (Addgene plasmid 12260 and 12259) were transfected with the JetPRIME (VMR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... membrane and envelope (CoV2-M-IRES-E, Addgene), and spike (nCoV-2-B117 or B117/M1237I ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The replacement donors were cloned sequentially into the corresponding cut sites of the dsDNA donor vector pHD-DsRed-attP (Addgene plasmid #51019). The primers used for generating gRNA and replacement donor constructs are listed in Table S4 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The GFP sequence was then cut out from this construct using SpeI and SbfI and replaced with a GAL4 sequence pBPGUw (Addgene plasmid #17575) vector using SpeI and SbfI.
-
bioRxiv - Evolutionary Biology 2023Quote: ... annealed and ligated into the BbsI sires of pU6-BbsI-chiRNA (Addgene plasmid #45946) (Gratz et al. ...
-
bioRxiv - Genetics 2023Quote: ... Synthesized oligos were amplified and restriction cloned into lentiGuide-puro (Addgene; 52963) by the MSKCC Gene Editing & Screening Core Facility ...
-
bioRxiv - Genomics 2023Quote: ... and Cas9-gRNA plasmid pX459-EN1201 (backbone from Addgene plamid #62988, guide from Addgene plasmid #9214434 ...
-
bioRxiv - Genomics 2023Quote: ... This integration was generated by co-transfection of the donor vector pEN396-pCAGGS-Tir1-V5-2A-PuroR TIGRE (Addgene plasmid, #92142) and Cas9-gRNA plasmid pX459-EN1201 (backbone from Addgene plamid #62988 ...
-
bioRxiv - Genomics 2023Quote: ... and Cas9-gRNA plasmid pX459-EN1201 (backbone from Addgene plamid #62988 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full length Fn-mScarlet cDNA was synthesized by Epoch Inc and then inserted into the MluI restriction site of the pR26 CAG AsisL/MluI plasmid (Addgene 74268, kind gift from Ralph Kuehn)45 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both the donor plasmid and the two guide RNA plasmids (pU6-BbsI-chiRNA, RRID:Addgene_45946) for each gene were injected into Cas9 embryos (BDSC Stock #51324 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the 24xMS2 loop cassette and a DsRed marker (from pHD-DsRed, RRID:Addgene_51434) inserted using a ClaI site for mew and AccII site for sog ...
-
bioRxiv - Developmental Biology 2023Quote: 24xMS2 loops70 (from pCR4-24XMS2SL-stable, RRID: Addgene_31865) were inserted into the first intron of sog and mew using two guide RNAs and one-step CRISPR Cas9 genome engineering71–73 ...