Labshake search
Citations for Addgene :
7701 - 7750 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: The plasmid RHCglo used for minigene assay was a gift from Thomas Cooper (Addgene plasmid #80169 ; http://n2t.net/addgene:80169 ; RRID:Addgene_80169) (49) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mut Atxn3 (LV-PGK-Atx3 72Q) (Alves et al., 2008) and Progerin (LMNAHG - pCDHblast MCSNard OST-LMNAd50 – kindly provided by Professor Tom Misteli (Addgene plasmid #22662) (Pegoraro et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Neuroscience 2023Quote: ... 16 μg of packaging plasmid (psPAX2; Addgene #12260), and 4 μg of envelope plasmid (pMD2.G ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Neuroscience 2023Quote: ... then inserted into an AgeI-/EcoRI-linearized pLenti-hSyn backbone (Addgene #86641) by Gibson assembly ...
-
bioRxiv - Neuroscience 2023Quote: ... Cortical injections to adult C57BL/6J mice additionally included a 1:300 dilution of rAAVretro-hSyn-Cre (Addgene #105553-AAVrg) to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Neuroscience 2023Quote: ... ALOD4 (Addgene 111026) was N- terminally tagged with NeonGreen ...
-
bioRxiv - Neuroscience 2023Quote: ... to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-CW3SL-EGFP74 was a gift from Bong-Kiun Kaang (Addgene plasmid #61463).
-
bioRxiv - Genetics 2023Quote: ... was obtained from Addgene. Mouse Atrx sgRNAs were designed using Benchling (https://www.benchling.com/) ...
-
bioRxiv - Genetics 2023Quote: The vector for CRISPR-cas9 pSpCas9(BB)-2A-GFP (PX458) (Addgene, #48138) was obtained from Addgene ...
-
bioRxiv - Genetics 2023Quote: ... sgRNAs were cloned individually into the plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) and then transfected into XEN cells using XfectTM transfection reagent (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... GRK2-CAAX (# 166224) and cAMPr (# 99143) were purchased from Addgene. The PM-GRK2-CT plasmid 110 and PTX-S1 constructs were previously described 111 ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 nl of undiluted pENN.AAV.CamKII 0.4.Cre.SV40 (Plasmid #105558, AAV5, Addgene) were injected into the CA1 area of the hippocampus ...
-
bioRxiv - Cell Biology 2023Quote: GFP-PTEN was a gift from Alonzo Ross (Addgene plasmid # 13039; http://n2t.net/addgene:13039;RRID:Addgene_13039)
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Genomics 2023Quote: ... and HA-tag were introduced by CRISPR/Cas9-mediated homologous recombination to the N-terminus of ZBTB24 protein (gRNAs are listed in Table S9 were cloned in pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138), the plasmids containing HA tag ...
-
bioRxiv - Genetics 2023Quote: ... it was expanded and 100 million cells were infected with a BFP-expressing gRNA lentiviral library (Addgene Pooled Library #67988) at an infection rate of 25-30% to keep the Multiplicity of Infection (MOI ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmids pCDNA3.1(+)-CMV-βarrestin2-TEV (Addgene plasmid #107245; http://n2t.net/addgene:107245; RRID:Addgene_107245) and Flag Snai1 6SA (Addgene plasmid #16221 ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmid pDONR223_NOTCH1_ICN (Addgene plasmid #82087 ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag Snai1 6SA (Addgene plasmid #16221; http://n2t.net/addgene:16221; RRID:Addgene_16221), plasmid pDONR223_NOTCH1_ICN (Addgene plasmid #82087 ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag Snai1 6SA (Addgene plasmid #16221 ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmid pDONR223_NOTCH1_ICN (Addgene plasmid #82087; http://n2t.net/addgene:82087; RRID:Addgene_82087), plasmid GPCR-TANGO and HTLA cells were a gift from the lab of Richard Axel ...
-
bioRxiv - Cancer Biology 2023Quote: ... pCDNA5-FLAG-BRD4-WT and pFLAG-CMV2-BRD4 ΔET plasmids were purchased from Addgene. pCDNA-Flag vector control plasmid was a kind gift from Dr ...
-
bioRxiv - Genomics 2023Quote: ... a Neomycin resistance gene and a negative selection marker expressing tagBFP and was derived from pDONOR-tagBFP-PSM-EGFP (Addgene 100603). Flanking the positive selection cassette ...
-
bioRxiv - Genomics 2023Quote: ... 10 μg payload DNA and 10 μg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Genomics 2023Quote: ... we first excised the U6-sgRNA cassette from the lentiCRISPR v2 plasmid (Addgene, 52961) by dual KpnI and EcoRI digestion followed by blunt end ligation ...
-
bioRxiv - Genomics 2023Quote: ... We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... The brdisc-FRT-tdTomato-2xSTOP-FRT-myrGFP (brdisc-switch) reporter was generated from pJFRC177 10xUAS-FRT-2xSTOP-FRT-myrGFP (Addgene 32149). The brdisc enhancer was restriction cloned into the HindIII and AatII sites ...
-
bioRxiv - Genomics 2023Quote: ... Based on the original lentiviral backbone plasmid (pHAGE-Luc2-IRES-ZsGreen, Addgene 164432), we replaced the Luc2-IRES-ZsGreen reporter with a cassette encoding H2B fused to Nanoluciferase (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids that express trak-1 and miro-1 sgRNAs were made by swapping the N19 sequence of the unc-119 sgRNA from the preexisting plasmid (Addgene #46169) (Friedland et al. ...
-
bioRxiv - Genomics 2023Quote: ... This gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) via the Zhang lab protocol (https://media.addgene.org/data/plasmids/62/62988/62988-attachment_KsK1asO9w4owD8K6wp8.pdf) ...
-
bioRxiv - Genomics 2023Quote: ... The PEmax coding sequence from the T7 promoter to downstream of the bGH-PolyA tail was amplified out of the pCMV-PEmax plasmid (Addgene #174820) with the following primers CGCCAGAACACAGGACCGGTTAATACGACTCACTATAGGGAGAG (forward primer ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 ug of DNA (the pegRNA plasmid and the pCMV-PE2 plasmid (Addgene #132775) at a 1:2 ratio by mass of pegRNA plasmid:PE2) ...
-
bioRxiv - Genomics 2023Quote: ... Guide sequences were cloned into pCAS (Addgene 60847) using Quickchange and the primer 5’-CGGGTGGCGAATGGGACTTT [20-mer guide sequence] GTTTTAGAGCTAGAAATAGC-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... coli transformed with plasmid pDZ2087 (pDZ2087 was a gift from David Waugh, Addgene plasmid # 92414)(29) ...
-
bioRxiv - Genetics 2023Quote: ... 5.4 μg of psPax2 (Addgene 12260), 1.2 μg of pMD2.G (Addgene 12259 ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Genetics 2023Quote: ... These plasmids were co-transfected with wild-type SpCas9 (RTW3027, Addgene plasmid # 139987) or the SpG variant capable of targeting sites encoding NGA PAMs (RTW4177 ...
-
bioRxiv - Cell Biology 2023Quote: ... 72hrs post transfection cells from both siMCU and siNT conditions were transfected with 1ug of eGFP-NFAT2 overexpression plasmid (Addgene#24219) using Lipofectamine 2000 reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Genetics 2023Quote: ... 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with 7.5 μg of of the plasmid pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036; http://n2t.net/addgene:22036; RRID:Addgene_22036), 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Genetics 2023Quote: ... 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454)) (103 ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with 7.5 μg of of the plasmid pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
bioRxiv - Cell Biology 2023Quote: ... RRE (pMDL-RRE; Addgene cat. 12251), and VSV-G (pMD2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the following plasmids were used: REV (pRSV-rev; Addgene cat. 12253), RRE (pMDL-RRE ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: The human α-SYN wild-type (Addgene ID #36046) and α-SYN (wt)-141C (Addgene ID #108866 ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... and α-SYN (wt)-141C (Addgene ID #108866) with a cysteine residue at C-terminus ...