Labshake search
Citations for Addgene :
7651 - 7700 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... a gift from Pietro De Camilli (Addgene plasmid #22198) (6) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-V1rb1 (Addgene, #16010) were gifts from Peter Mombaerts.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-Trpc2-probe1 (Addgene, #105473), pISH-Trpc2-probe2 (Addgene ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pGP-CMV-GCaMP6s was a gift from Douglas Kim (Addgene, #40753). pISH-Gucy1b2-probe1 (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... purchased from Addgene (Addgene plasmid # 181743 ...
-
bioRxiv - Biochemistry 2023Quote: ... SpRY was expressed from pET28-SpRY-NLS-6xHis (gbr2101) purchased from Addgene (Addgene plasmid # 181743 ...
-
bioRxiv - Biochemistry 2023Quote: The following plasmids were purchased from Addgene: HA-Ubiquitin WT (#17608) ...
-
bioRxiv - Neuroscience 2023Quote: rAAV9.EF1α.DIO.hChR2(H134R) (Addgene plasmid # 35507 AAV9) and pAAV-hSyn1-SIO-stGtACR2-FusionRed (Addgene viral prep # 105677-AAV1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mScarlet-I-Giantin (Addgene#85050) using In-Fusion Cloning kit (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... pMXs-IP spGFP-ERGIC53 (Addgene#38270), EGFP-GRASP65 (Addgene#137709) ...
-
bioRxiv - Cell Biology 2023Quote: ... and mScarlet-I-GRASP65 under the control of CMV promoter were generated from mCherry-ST (Addgene#55133), iRFP713 (Addgene#31857) ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiCRISPRv2-Puro (Feng Zhang, Addgene #52961), pCMVsp6-nls-hCas9-nls (Li-En Jao) ...
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G (Didier Trono, Addgene #12259), psPAX2 (Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNA-Cloning-Vector (George Church, Addgene #41824), pLV-Golgi eGFP (Pantelis Tsoulfas ...
-
bioRxiv - Cell Biology 2023Quote: ... pCDH-SBP-EGFP-Ecadherin (Franck Perez, Addgene #65290), pCDH-SBP-EGFP-Crb3 (Fernando Martín-Belmonte) ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... Mapt exon 4 and flanking the intron regions were PCR amplified using Phusion High-Fidelity DNA polymerase and inserted into NheI/BamHI digested pFlareA Plasmid (Addgene, 90249) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in vivo confocal imaging was used in cells co-transfected with the FRET-based ER-ZapCY1 probe (Addgene, Catalog nr. 36321)[75] and ZnT9-50Met ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2-FLEX-hOprm1 (Addgene plasmid# 166970) virus or AAV2- FLEX-sun1GFP (Addgene plasmid# 160141 ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Biochemistry 2023Quote: ... which was a gift from Scott Gradia (Addgene plasmid # 29656), through ligation-independent cloning (LIC ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Cell Biology 2023Quote: ... the envelope vector pMD2.G (#12260, Addgene) and the respective construct plasmid using TurboFect (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Cell Biology 2023Quote: ... was obtained by replacing the pgk1 promoter with the -1 to -1500 region of the PHO5 promoter and by replacing the gene for G418 resistance to the coding region of the LEU2 gene within the pCEV-G1-Km backbone (Addgene).
-
bioRxiv - Cell Biology 2023Quote: ... Primary MEFs were infected with retroviruses expressing either pWZL-Hygro (Addgene, #18750), pWZL-Hygro-CRE ...
-
bioRxiv - Molecular Biology 2023Quote: ... was transfected with the packaging vectors psPAX2 (Addgene, #12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Cell Biology 2023Quote: Targeted amplification of sgRNA sequences from the CROPseq backbone (Addgene, 86708) was performed in order to reliably identify the tag in each cell ...
-
bioRxiv - Molecular Biology 2023Quote: ... Short hairpin RNAs (shRNAs) against CUX1 was also generated by the production and infection of lentiviral particles using pTRIPZ-DoxOn-shCUX1-5150 (Addgene, #90469) and pTRIPZ shCUX1-5328 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: – CMV-Flag-GFP (Addgene plasmid #60360).
-
bioRxiv - Biophysics 2023Quote: AP1-2PH-PLCδ-GFP cells (From J. Snipper; vector from Addgene plasmid #35142) were grown in Minimum Essential Medium Eagle (EMEM ...
-
bioRxiv - Neuroscience 2023Quote: These sgRNAs were cloned individually into humanized pgRNA plasmids [pgRNA-humanized was a gift from Stanley Qi (Addgene plasmid # 44248)] ...
-
bioRxiv - Neuroscience 2023Quote: ... PH-PLCδ::GFP probe was used which was a gift from Tamas Balla (Addgene plasmid # 51407). The cDNA for human muscarinic acetylcholine receptor m1AchR was obtained from cDNA Resource Center (MAR0100000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... that created a double stranded break close to the mutation (sequence: CCAGATCCACTGCTGTCAGG) and cloned in pSpCas9(BB)-2A-Puro (Addgene, 48139).
-
bioRxiv - Neuroscience 2023Quote: ... pET-SUMO-hGSDMD was a gift from Hongbo Luo (Addgene plasmid # 111559 ...
-
bioRxiv - Cell Biology 2023Quote: ... and PG13-luc (Addgene plasmid # 16442) were transfected using lipofectamine 2000 (Thermo-Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... pLV-Golgi eGFP (Pantelis Tsoulfas, Addgene #79809).
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-RhoA Biosensor was a gift from Michael Glotzer (Addgene plasmid # 68026; http://n2t.net/addgene:68026; RRID:Addgene_68026).
-
bioRxiv - Neuroscience 2023Quote: ... plasmid pAAV-hSyn-DIO-GCaMP6s (Addgene plasmid 184284) was generated by inserting the GCaMP6s open reading frame from pGP-CMV-GCaMP6s (Addgene plasmid 40753 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-EF1a-Flpo (Addgene #55637) and AAV8-hSyn-DIO-HA-hM4D(Gi)-IRES-mCitrine (Addgene #50455 ...
-
bioRxiv - Cell Biology 2023Quote: ... RBL2 and non-targeting control shRNA lentiviral transfer plasmids were either purchased from Sigma or generated by cloning sequences into pSicoR-Ef1a-mCh-Puro-Puro (#31847;Addgene, see Supplemental Tables S2&S3) as previously described60 ...
-
bioRxiv - Cell Biology 2023Quote: ... Fragments of DISC1 were subcloned from existing vectors into pENTR1A no ccDB [36] (Dr. Eric Campeau, via Addgene, Watertown, MA, USA, clone 17398) at the SalI and XbaI sites ...
-
bioRxiv - Microbiology 2023Quote: Gene inserts from pDONR221-EGFP (Addgene #25899), pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257) ...
-
bioRxiv - Neuroscience 2023Quote: ... and pMD2.G (envelope plasmid, Addgene, Plasmid #12259) were diluted in 250 µL Opti-MEM (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... gRNAs were cloned into the pCFD5 expression vector (Addgene #73914)66 and donor constructs were generated to encode a floxed P3>DsRed reporter cassette (Addgene #51434 ...