Labshake search
Citations for Addgene :
7401 - 7450 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: FLAG-TAL1-short/long were cloned to MIGR1 vector (Addgene, plasmid#27490). HEK293T cells were co-transfected with the viral backbone vector pCMV-VSVG and pCL-Eco packaging vectors using polyethylenimine (PEI ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Neuroscience 2023Quote: Females were unilaterally injected with 300 nL of AA1-hSyn-Flex-GCaMP6s-WPre-SV40 (Addgene, #100845) in the aVMHvl (AP ...
-
bioRxiv - Molecular Biology 2023Quote: pcDNA-dCas9-p300 Core plasmids (D1399Y; plasmid #61358 and plasmid #61357) were purchased from Addgene. pSPgRNA (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSPgRNA (Addgene, plasmid #47108) was used as the gRNA plasmid ...
-
bioRxiv - Cell Biology 2023Quote: GFP-PTEN was a gift from Alonzo Ross (Addgene plasmid # 13039 ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Didier Trono (Addgene plasmid #12260 and #12259; http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259; RRID:Addgene_12260 and RRID:Addgene_12259). Polyjet (SignaGen SL100688 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Didier Trono (Addgene plasmid #12260 and #12259; http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259; RRID:Addgene_12260 and RRID:Addgene_12259). Polyjet (SignaGen SL100688 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Daniele Gilkes (Addgene plasmid #141148 and #141147 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988, Addgene, Teddington, UK) was modified by an EF1alpha promoter25 ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Wnt-sensitive TOPFlash enhancer (PTCF/LEF) were purchased from Addgene (#89573 ...
-
bioRxiv - Developmental Biology 2023Quote: zld, grh, or twi cDNA (isoforms RB, RH, and RA, respectively) were cloned into pMT-puro plasmid (Addgene) via Gibson cloning (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Developmental Biology 2023Quote: ... the piggyBac donor plasmid (Addgene, 40973) was altered to include a number of modifications (Bandler et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... were modified by adding pCAG-TdTomato (Addgene, 59462) and a capture sequence at the scaffold of sgRNA for 10x feature barcode retrieval (cs1 incorporated at the 3’ end ...
-
bioRxiv - Genomics 2023Quote: ... with pBABE-puro SV40 LT plasmid (Addgene # 13970 ...
-
bioRxiv - Biophysics 2023Quote: ... Nicolas Fawzi at Brown University (Addgene plasmid #98669) which was expressed and purified as previously 16,54 ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... and psPAX2 (Addgene, #12260) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligos containing the gene-specific sgRNA target were cloned into the LentiCRISPRv2 Blasticidin (Addgene, #83480). The CRISPR/Cas9 primer sequences were as followed:
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Developmental Biology 2023Quote: A short guide RNA (sgRNA) sequence (GCTGCTGGTGTGCCCCGGGCTGG) was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) as outlined in 49 ...
-
bioRxiv - Developmental Biology 2023Quote: ... we aimed to substitute the endogenous Cas9 cassette by targeting the Cas9 protein to the Cas9 DNA flanking regions either with a dCas9-VP64 donor sequence from Addgene plasmid 61425 or a dCas9-KRAB donor ...
-
bioRxiv - Developmental Biology 2023Quote: ... We first obtained a Rosa26 targeting vector with Puromycin selection cassette (pR26 CAG AsiSI/MluI, Addgene 74286, Ralf Kuehn lab, 48), linearized the vector with SwaI restriction digest ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Puro-Cas9 donor (Addgene plasmid 58409) as template and the following primer pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... amino acids 1220-1711) of 53BP1 from TP53BP1 cDNA (a gift from Anthony Davis) and cloned into a pBABE-zeo construct (Addgene). DLD-1 cells engineered to carry the dCas9-SunTag system and expressing H2B-mCherry were transduced with retroviruses that were packaged in 293GP cells for 24 hours and selected with 50 μg/mL zeocin for two weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... CDC42 WT (12599) and DN (12601) plasmids were obtained from Addgene [23] ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pFA6a-GFP(S65T)-His3MX6 (Longtine et al., 1998) was a gift from John Pringle (Addgene 41598; Addgene, Watertown, MA) and pFA6a-link-yoTagRFP-T-Kan (Lee et al. ...
-
bioRxiv - Genetics 2023Quote: ... The puromycin resistance gene was then subsequently replaced with EGFP using an amplified fragment from the pMLS-SV40-EGFP plasmid 126 (Addgene plasmid # 46919). The expression and activity of the single-vector CROPseq plasmid was tested by cloning in a sgRNA targeting the DNMT3B (sgRNA sequence ...
-
bioRxiv - Genetics 2023Quote: ... The EFS-SpCas9-P2A fragment was amplified from lentiCRISPRv2 125 (Addgene plasmid # 52961) using Q5 high-fidelity DNA polymerase ...
-
bioRxiv - Genetics 2023Quote: ... the EF1a promoter in the CROPseq-Guide-Puro 124 (Addgene plasmid # 86708) was replaced with the EFS promoter to drive the expression of SpCas9 using the Gibson Assembly method (NEBuilder HiFi DNA Assembly master mix) ...
-
bioRxiv - Genetics 2023Quote: ... Each of the sgRNAs was cloned into CROPseq-Guide-pEFS-SpCas9-p2a-puro backbone (Addgene: #99248). The sequences of all sgRNAs templates were confirmed by in-house Sanger sequencing ...
-
bioRxiv - Genetics 2023Quote: To generate a single-vector system CROPseq plasmid expressing both SpCas9 and sgRNA(CROPseq-EFS-SpCas9-P2A-EGFP; Addgene #99248), the EF1a promoter in the CROPseq-Guide-Puro 124 (Addgene plasmid # 86708 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mScarlet-I-Giantin (Addgene#85050) using In-Fusion Cloning kit (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... pMXs-IP spGFP-ERGIC53 (Addgene#38270), EGFP-GRASP65 (Addgene#137709) ...
-
bioRxiv - Cell Biology 2023Quote: ... and mScarlet-I-GRASP65 under the control of CMV promoter were generated from mCherry-ST (Addgene#55133), iRFP713 (Addgene#31857) ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiCRISPRv2-Puro (Feng Zhang, Addgene #52961), pCMVsp6-nls-hCas9-nls (Li-En Jao) ...
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G (Didier Trono, Addgene #12259), psPAX2 (Didier Trono ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid # 52962). For A3A and A3B knockout ...
-
bioRxiv - Microbiology 2023Quote: ... we cloned ∼750 bp of the regions upstream and downstream of the sRNA into the multiple cloning site of pSIE1 (a gift from Andrew Goodman, Addgene plasmid #136355 ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus were produced by transfecting HEK 293T cells with a mixture of PD-L1-pMIT1.1 (or PD-L2-pMIT1.1) and pCL-Eco (Addgene #12371) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Timothy Lu & Christopher Voigt (Addgene plasmids #68891 ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Timothy Lu & Christopher Voigt (Addgene plasmids #68891, http://n2t.net/addgene:68891, RRID:Addgene_68891 and #68896 ...
-
bioRxiv - Neuroscience 2023Quote: ... the pipette containing AAVPHP.S-CAG-FLEX-tdTomato virus (Addgene 28306-PHP.S, 1.8×1013 vg/mL) targeted at 2 locations in the mandibular branch spaced 250 um apart ...