Labshake search
Citations for Addgene :
7201 - 7250 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MLM3636 was a gift from Keith Joung (Addgene plasmid # 43860 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ppyCAG_RNaseH1_D210N was a gift from Xiang-Dong Fu (Addgene plasmid # 111904 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988; http://n2t.net/addgene:62988; RRID:Addgene_62988). pMSCV_PM_shRNA_Control_puro was a gift from Steve Elledge48 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848; http://n2t.net/addgene:122848 ; RRID:Addgene_122848). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ppyCAG_RNaseH1_WT was a gift from Xiang-Dong Fu (Addgene plasmid# 111906 ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260 ; RRID:Addgene_12260). pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pGEX6P1-hsRNASEH2BCA was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108692; http://n2t.net/addgene:108692; RRID:Addgene_108692). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Molecular Biology 2023Quote: pEGFP-RNASEH2B was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108697; http://n2t.net/addgene:108697; RRID:Addgene_108697). pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Microbiology 2023Quote: Plasmids for Sleeping Beauty transposition included pCMV(CAT)T7-SB100 (Addgene 34879) and an ISG54 promoter driving Nluc-2A-GFP cloned into the pSBbi-BB backbone (Addgene 60521).
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Microbiology 2023Quote: ... the gene was amplified and inserted into an expression vector backbone pCW-lic (Addgene, 26908). A polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary fibroblasts were immortalized with 293FT (Invitrogen)-derived supernatant containing a human telomerase reverse transcriptase (TERT) lentivirus that was generated with the plasmids pLV-hTERT-IRES-hygro (gift from Tobias Meyer; Addgene #85140)(24) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent mCherry under the human synapsin promoter in dHPC (AAV5-hSyn-DIO-mCherry, titer: 1.1 × 1013 vg/ml, Catalog #50459-AAV5, Addgene, Watertown, USA). For optogenetic experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... 11.4 μg pMDLg-RRE (#12251, Addgene), 5.4 μg pRSV-REV (#12253 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the transfection mixture was prepared by combining lentiviral packaging plasmids 7.5 μg pMD2.G (#12259, Addgene), 11.4 μg pMDLg-RRE (#12251 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613; Addgene plasmid # 60614 ...
-
bioRxiv - Microbiology 2023Quote: ... The pUCmini-iCAP-PHP.eB was a gift from Viviana Gradinaru (Addgene plasmid # 103005 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... we constructed CRISPR/Cas9 plasmids using the LentiCRISPRv2-puro vector (Addgene #98290) (61 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 μg pVSV-G (Addgene #8454), and 2.3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene, cat. 12260) and VSV-G DNA (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and VSV-G DNA (Addgene, cat. 8454) (24 ...
-
bioRxiv - Microbiology 2023Quote: ... Keith Joung (Addgene plasmids #43861 and #43860) as detailed elsewhere (Muller et al. ...
-
bioRxiv - Genetics 2023Quote: A plasmid construct for the expression of Q35::mCherry was generated by inserting the sequence encoding Q35 upstream of mCherry in pGH8 (gift from Erik Jorgensen; Addgene plasmid #19359) and replacing the promoter with a 880-base pair sequence corresponding to the vha-6 promoter using the NEBuilder HiFi DNA Assembly cloning kit ...
-
bioRxiv - Genetics 2023Quote: ... pHD-DsRed-attP-w+ was a gift from Kate O’Connor-Giles (Addgene plasmid # 80898 ...
-
bioRxiv - Genetics 2023Quote: ... Viruses were produced according to standard procedures using commercially available plasmids (pMD2.G Addgene #12259, psPAX Addgene #12260). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Genetics 2023Quote: ... Viruses were produced according to standard procedures using commercially available plasmids (pMD2.G Addgene #12259, psPAX Addgene #12260). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... the pKI1.1R plasmid (Addgene) was linearized by restriction digest with AarI (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Molecular Biology 2023Quote: ... a gift from Judy Lieberman (Addgene plasmid 27219 and 27220 ...
-
bioRxiv - Microbiology 2023Quote: SgRNA/Cas9 cloning vector pX459-mCherry (Cat no. 64324; Addgene) and pJET-UL39R-GFP-p53-Ul39L plasmid were used as controls in all transfection experiments for monitoring the cell viability along with the reporter gene expression.
-
bioRxiv - Microbiology 2023Quote: ... The CoV2-M-IRES-E (Addgene plasmid # 177938), Luc-T20 (Addgene plasmid # 177941 ...
-
bioRxiv - Microbiology 2023Quote: ... sgRNA/Cas9 cloning vector pX459-puro (Addgene, #62988), sgRNA/Cas9 cloning vector pX459-mCherry (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Luc-T20 (Addgene plasmid # 177941) and CoV2-N-WT-Hu1 (Addgene plasmid # 177937 ...
-
bioRxiv - Microbiology 2023Quote: pcDNA3.1 (+) IRES GFP plasmid (Addgene, #51406), sgRNA/Cas9 cloning vector pX459-puro (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... the pIRES2-EGFP-p53 WT Plasmid (Addgene, #49242)
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Genomics 2023Quote: ... psPAX2 and pMD2.G were gifts from Didier Trono (Addgene plasmid #12260 and #12259). pLV_hEF1a_rtTA3 was a gift from Ron Weiss addgene #61472 [40].
-
bioRxiv - Genomics 2023Quote: ... Each well was treated with 1.25 µg CRISPRoff plasmid (Addgene plasmid #167981), 1.25 µg gRNA plasmid (described above) ...
-
bioRxiv - Genomics 2023Quote: ... Each spacer’s sense and antisense oligonulceotide strands were annealed and ligated into a gRNA expression vector (pGuide, Addgene plasmid #64711). After transformations into competent E ...
-
bioRxiv - Genomics 2023Quote: ... Col2a1 sgRNA was cloned in the pX459 plasmid (Addgene, 48139) and designed to target CRISPR–Cas9 to chr15:97903847 (mm39) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nSauCas9D10A plasmid used for the orthogonal R-loop assay was also cloned by SDM using CMV-dSauCas9 (Addgene #138162) as a template ...
-
bioRxiv - Molecular Biology 2023Quote: ... U6-driven sgRNA plasmids for the various Cas effectors were cloned using pBluescript sgRNA expression plasmids (Addgene #122089 ...