Labshake search
Citations for Addgene :
7351 - 7400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Wnt10a and Wnt16 were originated from pcDNA-hWnt10a-V5 (Addgene 35939) or pcDNA-hWnt16-V5 (Addgene 35942 ...
-
bioRxiv - Molecular Biology 2023Quote: ... David Virshup and Xi He from the plasmid kit73 (Addgene kit # 1000000022). HALO*EBP-HA and HALO*EBP constructs were originated from a pBSM13-Pax7HALO plasmid that was designed in our lab ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... which was a gift from Scott Gradia (Addgene plasmid # 29656), through ligation-independent cloning (LIC ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Cell Biology 2023Quote: ... Mapt exon 4 and flanking the intron regions were PCR amplified using Phusion High-Fidelity DNA polymerase and inserted into NheI/BamHI digested pFlareA Plasmid (Addgene, 90249) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... an Fmr1 exon 3 DNA oligonucleotide was inserted into pLentiCRISPR (Addgene, 49535) adapted from published methods [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... that created a double stranded break close to the mutation (sequence: CCAGATCCACTGCTGTCAGG) and cloned in pSpCas9(BB)-2A-Puro (Addgene, 48139).
-
bioRxiv - Cell Biology 2023Quote: ... The pEGFP-N1- hDEK plasmid (DEK WT sequence inserted into eGFP reporter plasmid “peGFP-N1”; Addgene 6085-1) was used as a template for mutagenesis PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were generated using the lentivirus Trono group second generation packaging system (Addgene) and selected using puromycin resistance (2 µg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... the envelope vector pMD2.G (#12260, Addgene) and the respective construct plasmid using TurboFect (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Cancer Biology 2023Quote: Reporter targeting vector was generated by altering HR180-LGR5-iCT plasmid (Addgene #129094) into a plasmid compatible with insertion of homology arms using golden-gate cloning56 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and lenti-MS2-p65-HSF1-Hygro (Addgene #89308) were used to generate stable cell lines for gene activation ...
-
bioRxiv - Cancer Biology 2023Quote: LentiSAMv2 (Addgene #92062) and lenti-MS2-p65-HSF1-Hygro (Addgene #89308 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (Addgene #12260) were used to facilitate viral packaging of sgRNA vector plasmids.
-
bioRxiv - Genomics 2023Quote: ... and sequenced (Addgene #163751). 3µg of HDR template was then co-transfected with 1µg of hCas9 (a gift from George Church ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in vivo confocal imaging was used in cells co-transfected with the FRET-based ER-ZapCY1 probe (Addgene, Catalog nr. 36321)[75] and ZnT9-50Met ...
-
bioRxiv - Neuroscience 2023Quote: ... pET-SUMO-hGSDMD was a gift from Hongbo Luo (Addgene plasmid # 111559 ...
-
bioRxiv - Cell Biology 2023Quote: ... was obtained by replacing the pgk1 promoter with the -1 to -1500 region of the PHO5 promoter and by replacing the gene for G418 resistance to the coding region of the LEU2 gene within the pCEV-G1-Km backbone (Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... AAV2-FLEX-hOprm1 (Addgene plasmid# 166970) virus or AAV2- FLEX-sun1GFP (Addgene plasmid# 160141 ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Genomics 2023Quote: ... 2.106 SOX2-P2A-tagBFP cells were transfected with 50nM of plasmid expressing either miRFP670 (a gift from Vladislav Verkhusha; Addgene plasmid #79987 ...
-
bioRxiv - Genomics 2023Quote: ... 2.106 SOX2-P2A-tagBFP cells were transfected with 50nM of plasmid expressing either miRFP670 (a gift from Vladislav Verkhusha; Addgene plasmid #79987; http://n2t.net/addgene:79987; RRID:Addgene_79987), FOXA1-T2A-miRFP670 (Addgene plasmid #182335) ...
-
bioRxiv - Genomics 2023Quote: ... or NFIB-T2A-miRFP670 (Addgene plasmid #187222) in 5 replicates ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... a gift from Li-Lin Du (Addgene plasmid # 171124) (Zhang et al. ...
-
bioRxiv - Molecular Biology 2023Quote: – CMV-Flag-GFP (Addgene plasmid #60360).
-
bioRxiv - Biophysics 2023Quote: AP1-2PH-PLCδ-GFP cells (From J. Snipper; vector from Addgene plasmid #35142) were grown in Minimum Essential Medium Eagle (EMEM ...
-
bioRxiv - Neuroscience 2023Quote: These sgRNAs were cloned individually into humanized pgRNA plasmids [pgRNA-humanized was a gift from Stanley Qi (Addgene plasmid # 44248)] ...
-
bioRxiv - Neuroscience 2023Quote: ... PH-PLCδ::GFP probe was used which was a gift from Tamas Balla (Addgene plasmid # 51407). The cDNA for human muscarinic acetylcholine receptor m1AchR was obtained from cDNA Resource Center (MAR0100000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... a total of 9.45 μg of each library plasmids combined with 6.75 μg lentiviral packaging vector psPAX2 and 1.36 μg vesicular stomatitis virus G (VSV-G) envelope expressing plasmid pMD2.G (Addgene plasmids 12260 and 12259) were transfected with the JetPRIME (VMR ...
-
bioRxiv - Developmental Biology 2023Quote: ... These sgRNAs were inserted individually into lentiGuide-Puro plasmid (Addgene # 52963) following the cloning protocols provided from the plasmid depositor ...
-
bioRxiv - Developmental Biology 2023Quote: ... the three sgRNA expression cassettes were subcloned one by one from the three lentiGuide-Puro plasmids into a modified pLKO.1-TRC plasmid (additional multiple cloning site BclI-EsrGI-MluI-NheI-PstI-SalI-XbaI-XmaI was inserted between the original PpuMI and EcoRI sites in the pLKO.1-TRC plasmid (Addgene # 10878)) to make tandem sgRNA expression cassettes in the same lentiviral vector.
-
bioRxiv - Developmental Biology 2023Quote: ... 2A-EGFP fragment was cloned from pCAS9_GFP (Addgene # 44719) and the FRT-PGK-Neo-FRT cassette was cloned from pZero-FRT-Neo3R (kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene # 62988). Both donor and sgRNA plasmids for SIX2 reporter knockin were transfected into the H1 hESCs using the Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids used in this work included PKA biosensor pmAKAR3 (Allen and Zhang, 2006) from Jin Zhang (Johns Hopkins University pmCherry-FAK from Addgene (plasmid #35039).
-
bioRxiv - Genetics 2023Quote: ... pZCS36 (Addgene ID 193048), pZCS38 (Addgene ID193049) ...
-
bioRxiv - Genetics 2023Quote: ... the full resistance cassette was amplified from pCFJ910 (Addgene ID44481) and assembled into PCR linearized pUC19 vector to give pZCS38.
-
bioRxiv - Genetics 2023Quote: ... from pCFJ1663 (Addgene ID51484). Overlapping PCR was used to fuse both HygR fragments ...
-
bioRxiv - Genetics 2023Quote: ... pMS84 (Addgene ID 193852), pZCS36 (Addgene ID 193048) ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... For AHPH-GFP (Addgene; catalog no. 68026) active RhoA biosensor cells were fixed using 10% trichloroacetic acid (TCA ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Neuroscience 2023Quote: ... AAV-rg/Cre (Addgene viral prep #24593-AAVrg) was used in PTENf/f;RosatdTomato mice and control RosatdTomato mice ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-rg/Cre was used to delete PTEN controls received AAV-rg/GFP (Addgene viral prep #37825-AAVrg). In study 4 ...
-
bioRxiv - Plant Biology 2023Quote: ... an expression clone was generated by cloning the tdT coding sequence (amplified from an AddGene-derived plasmid (Shaner et al., 2004)) into the BglII cloning site of plasmid pLAU2 using Gibson assembly (Idnurm et al. ...