Labshake search
Citations for Addgene :
7301 - 7350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning was performed using the single-step digestion-ligation protocol from the Zhang lab (available on the Zhang lab Addgene page). To validate each guide ...
-
bioRxiv - Cell Biology 2023Quote: ... The synthesis protocol provided by the Church lab (available on Addgene) was followed to generate a plasmid with an sgRNA against p53 (5’GATCCACTCACAGTTTCCAT’3) ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS-Cas9 and U2OSp53KO-Cas9 cells were generated using viral transduction of the lentiCas9-Blast plasmid (Addgene, #52962), followed by a 5-day selection with 5 µg/mL blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... This library was amplified according to the Zhang lab’s protocol (available on Addgene) and virus was generated using 293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene 54967 [63]).
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Cell Biology 2023Quote: The CRISPR HR oligo was generated by PCR using UPRT F and UPRT R primers and the 5’UPRT-pAPT1-APT1-Halo-3’UPRT plasmid as a template with Q5 high fidelity polymerase and 50ul of PCR reaction was cotransfected with 25 μg of pSag1::Cas9::U6::sgUPRT plasmid [45] (AddGene plasmid # 54467) into 1×107 TgMyoF-mAID parasites [39] ...
-
bioRxiv - Genomics 2023Quote: ... For the rescue experiment CTCF pLoF clones C13 and C21 were transfected with either pKS004-pCAGGS-3XFlag-CTCF-eGFP plasmid (a gift from Elphege Nora, Addgene plasmid #156438) [53] or GFP-NLS (a plasmid expressing GFP fused to a nuclear localization signal that was a gift from Michael Bustin ...
-
bioRxiv - Biophysics 2023Quote: ... The mCherry-Sec61β plasmid was acquired from Addgene (49155).
-
bioRxiv - Cancer Biology 2023Quote: ... E-cadherin reporter (pHAGE-E-cadherin-RFP, Addgene #79603), cell cycle reporter (pBOB-EF1-FastFUCCI-Puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell membrane marker (pLenti-mCherry-CAAX, Addgene #129285), E-cadherin reporter (pHAGE-E-cadherin-RFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... cell cycle reporter (pBOB-EF1-FastFUCCI-Puro, Addgene #86849), LV-YFP (Addgene #26000) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLenti-H2B-iRFP720 (Addgene #128961) were generated using standard lentivirus mediated stable cell lone preparation protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lung KP cells stably expressing a hypoxia reporter (pLenti-5XHRE-GFP, Addgene #128958, denoted here as HRE-GFP), cell membrane marker (pLenti-mCherry-CAAX ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-YFP (Addgene #26000), and pLenti-H2B-iRFP720 (Addgene #128961 ...
-
bioRxiv - Genomics 2023Quote: ... and psPAX2 (Addgene #12260) were used to facilitate viral packaging of sgRNAs and single vector plasmids.
-
bioRxiv - Genomics 2023Quote: ... and lenti-MS2-p65-HSF1-Hygro (Addgene #89308) were used to generate stable cell lines for gene knockout and activation ...
-
bioRxiv - Genomics 2023Quote: ... pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Genomics 2023Quote: LentiCRISPRv2 (Addgene #52961) or lentiSAMv2 (Addgene #92062 ...
-
bioRxiv - Genomics 2023Quote: ... or lentiSAMv2 (Addgene #92062) and lenti-MS2-p65-HSF1-Hygro (Addgene #89308 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene # 8449) and VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and VSVG envelope construct (Addgene #8454). Lentivirus-containing media was harvested at 96-h and added to clonal KSR1 KO HCT116 and H460 cells ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA sequences targeting KSR1 or non-targeting control were inserted into pCAG-SpCas9-GFP-U6-gRNA (Addgene #79144, gift of Jizhong Zou). PEI transfection was used to insert pCAG-SpCas9-GFP-U6-sgKSR1 or non-targeting control into H460 and HCT116 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... or pHAGE-puro empty vector (Addgene #118692) (128 ...
-
bioRxiv - Cancer Biology 2023Quote: sgRNA sequences targeting KSR1 or non-targeting control were inserted into pLentiCRISPRv2GFP (Addgene #82416). The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were infected with lentiviruses expressing WT p110α (Addgene #116771), p110αH1047R (Addgene #116500) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pMD2.G envelope construct (Addgene #12259). Lentivirus-containing media was harvested at 96-h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259) and pMD2.G envelope construct (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2023Quote: ... p110αH1047R (Addgene #116500), or pHAGE-puro empty vector (Addgene #118692 ...
-
bioRxiv - Cancer Biology 2023Quote: Murine KSR1 was cloned into MSCV-IRES-KSR1-GFP (Addgene #25973) and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene # 8449 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025 ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: ... p2xFlag CMV2-YAP2 (YAP1; Addgene #19045) or p2xFlag CMV2-WWTR1 (TAZ) ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025; RRID:Addgene_19025; Kanai et al., 2000).
-
bioRxiv - Cancer Biology 2023Quote: ... in which we cloned a gRNA targeting the genomic p53 sequence: TATCTGAGCAGCGCTCATGG as described by the cloning protocol provided by Addgene (#87360). Organoids were broken up into single cells using a 40 min incubation (37°c ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we produced lentiviruses in HEK293T cells using TLCV2 lentiviral vector (Addgene #87360) expressing a Tet-inducible CRISPR-Cas9 protein ...
-
bioRxiv - Molecular Biology 2023Quote: ... template libraries were constructed by PCR sewing and cloned into pRSII413 (a gift from Steven Haase, Addgene plasmid #35450; http://n2t.net/addgene:35450; RRID:Addgene_35450) 89 by ligation (Figure S1A) ...
-
bioRxiv - Molecular Biology 2023Quote: ... template libraries were constructed by PCR sewing and cloned into pRSII413 (a gift from Steven Haase, Addgene plasmid #35450 ...
-
bioRxiv - Cancer Biology 2023Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cell Biology 2023Quote: pGAMA-YAP was a gift from Miguel Ramalho-Santos (Addgene plasmid #74942). Site-directed mutagenesis was performed on the pGAMA-YAP construct to create p-GAMA-YAP-S127A using the QuikChange Lightning kit (Agilent Technologies #210513) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or pcDNA-hWnt16-V5 (Addgene 35942) plasmid respectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMD2.G and psPax2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Physiology 2023Quote: FLAG-IKK2 kinase inactive K44M (IKK2DN, Addgene, #15466) was cloned into pLenti-CMV-Puro DEST vector (Addgene ...
-
bioRxiv - Physiology 2023Quote: ... was cloned into pLenti-CMV-Puro DEST vector (Addgene, #17452) using a Gateway cloning system (Invitrogen) ...