Labshake search
Citations for Addgene :
7151 - 7200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pCW-Cas9 (Addgene plasmid # 50661) were a gift from Eric Lander & David Sabatini8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ORF57 Pr pGL4.16 (Addgene 120378) have been previously described (7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMCB320 (Addgene 89359) was a gift from Michael Bassik ...
-
bioRxiv - Molecular Biology 2023Quote: pLX-sgRNA (Addgene plasmid # 50662) and pCW-Cas9 (Addgene plasmid # 50661 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Molecular Biology 2023Quote: EIF2A cDNA was cloned from pDONR223_EIF2A_WT (Addgene, 82111). EIF2A-TEV-GFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... LbuCas13a and LshCas13a were a gift from Jennifer Doudna (Addgene plasmids #83482 and #83487). LwaCas13a ...
-
bioRxiv - Molecular Biology 2023Quote: The Human GeCKOv2 CRISPR knockout pooled library19 (Addgene 1000000048), which contains 6 sgRNAs for each gene and 2,000 non-targeting control sgRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with pbabe-cyclinD1+CDK4R24C (gift of Christopher Counter, Addgene) 36 and pLV-hTERT-IRES-hygro (gift of Tobias Meyer ...
-
bioRxiv - Molecular Biology 2023Quote: pKI1.1R (Addgene plasmid #85808; http://n2t.net/addgene:85808; RRID:Addgene_85808) [54] was used to introduce sgRNAs (see Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: pKI1.1R (Addgene plasmid #85808 ...
-
bioRxiv - Molecular Biology 2023Quote: ... expressed in the pCRISPRi-v2 expression vector (Addgene, Cat#84832). Plasmid sublibraries were separately packaged in HEK 293T Lenti-X cells and transduced into the CRISPRi dual color reporter line at an MOI < 1 where the percentage of transduced cells by BFP expression after 2 days post-transduction was 20%-30% ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Sub-confluent HEK293T cells were co-transfected with 2.6 μg pMD2G (Addgene, USA), 7.4 μg psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... and pMG36e vector (Addgene, MA, USA) were used in the cloning and recombinant expression experiments ...
-
bioRxiv - Microbiology 2023Quote: ... 7.4 μg psPAX2 (Addgene) and 10 μg pLVTHM with 10 μl jetPEI (Polyplus transfection ...
-
bioRxiv - Microbiology 2023Quote: ... and finally in pMG36e vector (Addgene, MA, USA) under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: N-terminal histidine tagged wild-type VCP was obtained from Addgene (plasmid #12373 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... The parental strains Mtb Erdman wild-type and espA-tn were electroporated with the plasmid pKM461 (Addgene, #108320) expressing tetracycline-inducible Che9c phage RecT annealase and Bxb1 phage integrase (80) ...
-
bioRxiv - Microbiology 2023Quote: ... bacteria were electroporated with the payload plasmid pKM496 (Addgene, #109301) (80 ...
-
bioRxiv - Microbiology 2023Quote: ... or ORF6 (Addgene, cat. 141387) (25 ng ...
-
bioRxiv - Microbiology 2023Quote: The ISRE-Luc reporter plasmid (32) (25 ng) was either transfected alone or co-transfected with a plasmid expressing SARS-CoV-2 genes NSP13 (Addgene, cat. 141379) (25 ng) ...
-
bioRxiv - Microbiology 2023Quote: ... first pCQ11:mNeongreen was constructed by restriction digest substitution of gfp in pCQ11:gfp with mNeongreen obtained from pLOM-S-mNeongreen-EC18153 (Julian Hibberd, Addgene plasmid # 137075 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200) into pcDNA3(C-HA ...
-
bioRxiv - Microbiology 2023Quote: ... pDisplay-pHuji was from Addgene (Cat# 61556). Gag-EcpH was constructed by Dr ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pKOV (Addgene, USA) was used to delete the gene of interest ...
-
bioRxiv - Microbiology 2023Quote: ... Two gRNA binding sites near the 3’ region of each gene of interest were identified using EuPaGDT Editing of the previously modified pTREX-n-Cas9 plasmid 51 (Addgene plasmid 68708), performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids pCAGGS-CD4-Myc (Addgene, 58537), and pRP-mCherry/Puro-CAG>hCXCR4 (VectorBuilder ...
-
bioRxiv - Molecular Biology 2023Quote: ... using pRS315 (Addgene Plasmid #3974) and screened by growing transformed yeast on SC dropout plates lacking leucine ...
-
bioRxiv - Molecular Biology 2023Quote: ... pEGFP-C1-RelA (GFP-p65, #23255) is available from Addgene (Watertown, MA, USA). pIRES2-GFP (#6029-1) ...
-
bioRxiv - Microbiology 2023Quote: ... pFA6a-link-ymNeongreen-URA3 and pDRF1-GW ymYPET were a gift from Bas Teusink (Addgene plasmid # 118453 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was a gift from Ling-Ling Chen (Addgene plasmid # 132400)(Yang et al. ...
-
bioRxiv - Microbiology 2023Quote: ... pUC19 - T7 pro - IRES - EGFP was a gift from Fei Chen (Addgene plasmid # 138586; http://n2t.net/addgene:138586; RRID: Addgene_138586). All the plasmids used in this study were verified by Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: ... pUC19 - T7 pro - IRES - EGFP was a gift from Fei Chen (Addgene plasmid # 138586 ...
-
bioRxiv - Microbiology 2023Quote: ... The backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro was linearized by PCR from Addgene plasmid # 141395 with primers pLVX-EF1alpha_Fw (ctcgaaggcggcggg ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro encoding eGFP was obtained from Addgene (# 141395). The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pCMV6-AN-DDK-Fam122a was generated using SgfI/MluI restriction sites from the precision shuttle system (pCMV6-AN-DDK-Pol Iota-A kind gift from Roger Woodgate Addgene #131228). pCMV6-AN-mGFP and pCMV6-AN-mRFP plasmids were kind gifts from Richard Katz with Fam122a inserted using SgfI/MluI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were first transduced with the Cas9 expression vector pHRSIN-PSFFV-Cas9-PPGK-Blasticidin73 or FUCas9Cherry (a gift from Marco Herold, Addgene #70182)74 ...
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Single guide RNA (sgRNA) oligonucleotides (Integrated DNA Technologies) were cloned into lentiviral expression vectors pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene #50946, a gift from Kosuke Yusa)67 as described ...
-
bioRxiv - Molecular Biology 2023Quote: ... which encodes puromycin and BFP selection markers obtained from Addgene #50946 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these double stranded oligonucleotides were ligated with pU6-(BbsI)_CBh-Cas9-T2A-mCherry plasmid backbone (provided by Ralf Kuehn, Addgene catalog number 64324) (Chu et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA5-FRT-TO-EGFP-AID was a gift from Andrew Holland (Addgene plasmid # 80075 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMSCVpuro-DEST was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119745; http://n2t.net/addgene:119745; RRID:Addgene_119745). ppyCAG_RNaseH1_WT was a gift from Xiang-Dong Fu (Addgene plasmid# 111906 ...