Labshake search
Citations for Addgene :
5051 - 5100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... EYFP-DRP1 was obtained from Addgene (45160). For GST-purification ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...
-
bioRxiv - Cell Biology 2024Quote: The expression plasmids pCDNA5 FRT/TO-NeoR-HA-VPS35 WT and [D620N] were generated by subcloning either pcDNA5D-FRT/TO-HA-VPS35-WT (MRC PPU; DU26467) or pcDNA5D-FRT/TO-HA-VPS35-D620N (MRC PPU; DU26878) into the vector pcDNA5/FRT/TO-neo (Addgene; 41000). Prior to transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded per well of a 6-well plate and co-transfected with 2.8 µg pHAGE-mKeima-LGALS3 (Addgene; 175780), 2.3 µg pPAX2 (Addgene ...
-
bioRxiv - Genomics 2024Quote: ... Janina Lewis (Addgene plasmid #191377) and purchased from Addgene111.
-
bioRxiv - Genomics 2024Quote: ... was used as a shuttle vector and purchased from Addgene (Watertown, MA)109 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCMV-VSV-G (Addgene #8454), and pRSV-Rev (Addgene #12253 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral particles were generated by co-transfecting 1.5 µg of total DNA of pMDLg/pRRE (Addgene #12251), pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNA was sub-cloned in FLAG-HA-pcDNA3.1- (Addgene; 52535) to generate N-terminally Flag-HA tagged MED4 cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid for ID2 overexpression was from Addgene (Plasmid #83096). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVs encoding FlpO-dependent excitatory designer receptors exclusively activated by designer drugs (DREADDs) (titer = 2.5 x 1013 GC/ml, Addgene 154868; RRID:Addgene_154868) were injected into infralimbic subregion of mPFC (IL-mPFC ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVs encoding FlpO-dependent excitatory designer receptors exclusively activated by designer drugs (DREADDs) (titer = 2.5 x 1013 GC/ml, Addgene 154868; RRID:Addgene_154868) were injected into infralimbic subregion of mPFC (IL-mPFC ...
-
bioRxiv - Neuroscience 2024Quote: ... Xph20-GFP and Xph20-mRuby2 (Addgene #135,530 pCAG_Xph20-eGFP-CCR5TC ...
-
bioRxiv - Neuroscience 2024Quote: ... astrocytes were labeled via injections of a membrane-localized GFP virus with an astrocyte promoter (AAV.GfaABC1D.LcK-GFP, Addgene #105598-AAV5) into the CeA (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... USA) from the following plasmid: pZac2.1-GfaABC1D-GAT3-HA-p2A-mCherry (Addgene, #117722). GAT3 knockdown in astrocytes was achieved through delivery of an astrocyte-selective AAV5 serotype virus encoding a GAT3 shRNA[59] (pENN.AAV.HI.shR.GAT3.CMV.ZsGreen.SV40 plasmid obtained from Penn Vector Core ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV8-EF1a-Con/Fon-mCherry (Addgene 137132) was injected into the VTA (relative to bregma AP ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-Con/Foff-GCaMP6m (Addgene 137120), AAV8-nEF-Con/Fon-ChR2-mCherry (Addgene 137142) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-nEF-Con/Fon-ChR2-mCherry (Addgene 137142), or AAV8-EF1a-Con/Fon-mCherry (Addgene 137132 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-EF1a-Con/Fon-GCaMP6M (Addgene 137119), AAV8-hSyn-Con/Foff-GCaMP6m (Addgene 137120) ...
-
bioRxiv - Neuroscience 2024Quote: ... a gift from William Wisden (Addgene plasmid #71383) 96 was inserted into 3’-UTR of GFP in pAAV-Ef1a-DIO GFP plasmid in similar way ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragment was purified by electrophoresis and cloned into a pJFRC-MUH plasmid (Addgene #26213) in the XbaI/NotI subcloning site ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3xHA tag (synthesized by Twist Biosciences) was subcloned into the pGP-AAV-syn-jGCaMP8s plasmid vector (Addgene: 162374). Viral vectors were commercially prepared (Virovek ...
-
bioRxiv - Neuroscience 2024Quote: rgAAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene #105540-AAVrg, 7×1012 vg/ml), Ef1α.DIO.Synaptophysin-mRuby and Ef1α.FLEX.Synaptophysin.GFP (both generous gifts from Dr Marc Fuccillo ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV.hSyn.FLEx.mGFP-2A-Synaptophysin.mRuby (Addgene #71760-AAV1, 9.8×10¹² vg/mL) were used for tracing ...
-
bioRxiv - Neuroscience 2024Quote: ... with a BFP-marked sgRNA expression cassette (Addgene catalog #107722) containing an sgRNA targeting the GRN promoter ...
-
bioRxiv - Neuroscience 2024Quote: ... while DH5 alpha was employed for propagating the psPAX2 (Addgene plasmid #12260) packaging plasmid and the pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2024Quote: ... Addgene plasmid # 30174)122 or the pMSP12::mCherry plasmid (a gift from Lalita Ramakrishnan; Addgene plasmid # 30167) to generate Mtb-Wasabi and Mtb-mCherry ...
-
bioRxiv - Immunology 2024Quote: ... Mtb was transformed with the pTEC15 plasmid (a gift from Lalita Ramakrishnan; Addgene plasmid # 30174)122 or the pMSP12::mCherry plasmid (a gift from Lalita Ramakrishnan ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were transduced with psPAX2 (Addgene, 12260), pVSVg ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we used the pAND plasmid (Addgene #49377) (Stanton et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL60 (Addgene). These FAP sequences and the pcDNA3.1 backbone were used for generating the FAP-GFP-KDEL ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transformed with pET28a plasmid encoding the amber mutant TTC5 and the pEVOL-pBpF plasmid (Addgene plasmid #31190). Cells were grown at 37 °C in LB containing 50 μg/mL kanamycin and 25 μg/mL chloramphenicol and induced with 0.2 % L-arabinose at an A600 of 0.3 for 30 min followed by a second induction with 0.2 mM IPTG at an A600 of ∼0.6 at 16 °C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... VC-TUBA1B/TUBB-P2A-VN-TTC5 constructs were synthetized by Twist Bioscience (used Venus sequence from Addgene plasmid #10580453) and TTC5 mutants generated by site-directed mutagenesis ...
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... The REX-Shh-promoter::lacZ construct was created by introducing the REX element into the PCR4-Shh-promoter::lacZ-H11 vector (Addgene Plasmid #139098) (Kvon et al. ...
-
bioRxiv - Immunology 2024Quote: ... oligo pairs were annealed and cloned into the pLentiGuide-Puro (Addgene #52963). sgRNA inserts were confirmed by sequencing ...
-
bioRxiv - Immunology 2024Quote: ... VectorBuilder) by using the primers listed in Table S2 and inserted into the Str-KDEL_TNF-SBP-mCherry (#65279, Addgene) via restriction digestion with AscI and EcoRI (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Both insert and the Ii-Str_TNF-SBP-EGFP (#65280, Addgene) vector were digested using AscI and SbfI (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Synthetic Biology 2024Quote: ... OmpA-TaSil silicatein was inserted into vector pBbS5a-RFP (56) (Addgene #35283) replacing the vector’s RFP gene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pCAT20115 was purchased from Addgene (#134878) and used as a backbone for further plasmid construction ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV-TRE-fDIO-GFP-IRES-tTA (Addgene #118026) in a 1:50 ratio in the barrel cortex ...
-
bioRxiv - Neuroscience 2024Quote: ... or the Cre-dependent Gi/o-coupled DREADD vector (AAV8-hSyn-DIO-hM4d-mCherry, Addgene, Watertown, MA) into the CeA (AP −1.06 ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085; http://n2t.net/addgene:86085; RRID:Addgene_86085). Mutagenic primers harboring the desired variants were used in a PCR reaction with wild type human HMGCR sequence as the template ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCMV-SPORT6-hHMGCR1 was a gift from Anne Galy (Addgene plasmid # 86085 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We obtained plasmids from Addgene and transformed the pCas9-CR4 (ID ...
-
bioRxiv - Genetics 2024Quote: pCDF5-U6-[4xgRNA-tRNA]-GFP was generated by cloning the 4 gRNAs targeting GFP from (Ma et al., 2016) in pCDF5 (Addgene #Plasmid #73914) (Port and Bullock ...