Labshake search
Citations for Addgene :
4951 - 5000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... All mutual repression circuits were obtained from the pECJ3 plasmid (gift from Dr. James Collins, Addgene plasmid # 75465)21 and harbored in a plasmid with a ColE1 origin ...
-
bioRxiv - Synthetic Biology 2024Quote: A GFP-based fluorescent cAMP biosensor was made by cloning G-Flamp2 from Addgene plasmid # 19278242 and cloning into the pCDH lentivirus backbone.
-
bioRxiv - Synthetic Biology 2024Quote: A GFP-based fluorescent calcium biosensor was made by cloning GCaMP6s from Addgene plasmid #4075341 and cloning into the pCDH lentivirus backbone ...
-
bioRxiv - Synthetic Biology 2024Quote: An mCherry-based fluorescent DAG biosensor was made by C-terminally tagging mCherry to the C1PKCγ from Addgene plasmid #2120540 and cloning into the pCDH lentivirus backbone ...
-
bioRxiv - Molecular Biology 2024Quote: ... Drug cassettes were excised following each allele knockout via transient expression of Cre recombinase from pLEW100Cre_del_tetO (Addgene plasmid 24019 ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... which contains a gRNA scaffold and SpCas9 (Plasmid #48183, Addgene, Watertown, MA). A surveyor assay was used for testing the activity of gRNA according to the manufacturer’s instructions (Cat#1075931 ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... The first gRNA was cloned into the 1179_pAAV-U6-BbsI-gRNA-CB-EmGFP backbone (Plasmid#89060, Addgene, Watertown, MA; RRID:Addgene_89060) using BbsI cloning sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... obtained from Shinya Yamanaka (Addgene plasmid # 13459; http://n2t.net/addgene:13459; RRID:Addgene_13459) (Maruyama et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The ho1-pcy gene was derived from the pNO286-3 plasmid (Addgene #107746) that was deposited by Ong et al.59 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli MDS42 as wild-type and Ec_Syn61 (Addgene #174513) as a 61-codon variant of E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the pCAG promoter was replaced with 4xHRE_YB TATA for hypoxia recording (Addgene #117399)64 or 7xTCF/LEF for Wnt recording (Addgene #12456)65 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Mammalian Toolkit was a gift from Hana El-Samad (Addgene kit #1000000180). For continuous propagation of cells containing the CHYRON locus ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 11.1 µg of a Cas9-expressing plasmid (Addgene #41815)69 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an oxygen-dependent degron from one of our previously described plasmids (Addgene #132667)36 was appended to Cas9 in the hypoxia-recording cassette ...
-
bioRxiv - Molecular Biology 2024Quote: We adopted the CRISPR-Cas9 protocol according to manufacturer protocols (Addgene). Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The TdT gene was cloned into a pET28a expression vector (Addgene #69864-3) with an N-terminal 10xHis tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The plasmid for heterologous expression with alcohol inducible promoters pYFAC-CH2-ubi-Y-pyrG (Addgene ID# 221131) and pYFAC-CH2-ubi-M-pyrG (Addgene ID# 221132 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... C0000: pMOD_C0000 (#91081, Addgene) for CRISPR knockout and activation systems in plants ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PgpdA-mCherry expression cassette was amplified from pRecomb-loxP-mCherry-4Gcloningsite-lox2272-66 (Addgene ID# 168787). The gRNA expression cassette was amplified from pCRI040 which contains four Cas12a crRNAs targeting upstream of micA (Roux et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T7 terminator and RBS were first amplified from the plasmid Ubiquitin WT16 (Cat#12647, Addgene) and added to pgRNA-bacteria7 using Golden gate cloning17 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... D100: pTRANS_100 (#91198, Addgene) for protoplast system ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and pYFAC-CH2-ubi-M-pyrG (Addgene ID# 221132) incorporate the four-promoter expression cassette from pYFAC-CH2 (Addgene ID #168978 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... incorporate the four-promoter expression cassette from pYFAC-CH2 (Addgene ID #168978) (Hu et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pYFAC-ubi-Y-pyrG (Addgene ID# 184497), pYFAC-ubi-M-pyrG (Addgene ID# 184498 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A3701: pMOD_A3701 (#91052, Addgene) for CRISPR activation system in N ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A4110: pMOD_A4110 (#91056, Addgene) CRISPR activation system in maize ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a gift from Christopher Voigt (Addgene Kit #1000000137), were utilized in this study as PCR templates and/or intermediate DNA assembly hosts (19).
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The cumate-inducible system cassette was amplified from plasmid pCT5-bac2.0 (Addgene, #119872 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a constitutively expressed chloramphenicol resistance marker and SpCas9 and tracrRNA (from pCas940,105, Addgene #42876). The complete sequence of pRedCas2 is available in Supplementary Data 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and bet (from pORTMAGE-363, Addgene plasmid # 72678; http://n2t.net/addgene:72678; RRID:Addgene_72678), a p15A origin-of-replication ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 16 ng pRL-SV40P (Addgene #27163) per well using lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... psPAX2 (a gift from Didier Trono; Addgene_12260), and pMD2.G (a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2024Quote: The pooled genome-wide CRISPR knockout library (Addgene, #1000000132) was kindly provided by Prof ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cancer Biology 2024Quote: ... We then extracted the corresponding sgRNA sequences and annotations for these genes from the Human CRISPR Knockout Library H3 (contributed by Profs. X. Shirley Liu and Myles Brown, Addgene pooled library #133914). On average ...
-
bioRxiv - Cancer Biology 2024Quote: For RNF2 knock-out we used pLKO5.sgRNA.EFS.GFP (Addgene, 57822) vector targeting the following sequences ...
-
bioRxiv - Systems Biology 2024Quote: ... and the corresponding sgRNA sequence (GTGCGAGTAGAAAACGTTAA) was cloned into the pX459 plasmid (Addgene #62988) using BbsI Golden Gate cloning ...
-
bioRxiv - Cancer Biology 2024Quote: Two independent sgRNAs (Supplementary Table 6) were designed for each target gene and cloned into lentiCRISPRv2-blast vector (Addgene #83480) or lentiCRISPRv2-puro vector (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or lentiCRISPRv2-puro vector (Addgene #52961) which expresses Cas9 and sgRNA simultaneously once transduced into target cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... we first replaced Puromycin with a Blasticidin resistance marker in LT3GEPIR (Addgene plasmid # 111177), a gift from Johannes Zuber (11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The latter targeting vectors were cloned by linearizing cTGME shPten (Addgene plasmid #135667) (14 ...
-
bioRxiv - Systems Biology 2024Quote: ... Lentiviral constructs of either RGEDI2 or pHR-hSyn:EGFP (Addgene #114215)3 were added to the cell suspension at 5 MOI at the time of passage and removed after 48 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... and the homology arms and gBlock were inserted into the pUC18 plasmid (Addgene #50004) linearized with HindIII and BamHI.
-
bioRxiv - Systems Biology 2024Quote: ... Individual sgRNA was cloned into lentiviral vector pMK1334 expressing BFP (Addgene Cat# 127965). Lentiviruses carrying sgRNAs were produced in Lenti-X 293T cells (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK293T cells were co-transfected with lenti-EF1a-dCas9-KRAB-Puro plasmid (a gift from Kristen Brennand; Addgene_99372) or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and pMD2.G (a gift from Didier Trono; Addgene_12259) using TransIT-Lenti Transfection Reagent (Mirus Bio ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach; Addgene_83889), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The gRNA expression empty vector lentiGuide-Puro was a gift from Feng Zhang (Addgene_52963). pCMV-FLAG LAP2 was a gift from Joan Massague (Addgene_15738) ...