-
No products found
because this supplier's products are not listed.
Ahmet Yetiman, Mehmet Horzum, Mikail Akbulut,
bioRxiv - Microbiology 2022
Quote:
... The AGA52 was grown in MRS broth (0.25% dextrose + 0.3% ox bile containing) supplemented with 100ppm cholesterol (5-cholesten-3β-ol (Sigma, Merck GmbH, Darmstadt, Germany), dissolved in 2-propanol ...
-
No products found
because this supplier's products are not listed.
Mieko Tokano, et al.,
bioRxiv - Immunology 2022
Quote:
... or an inhibitor of CD73 inhibitor (adenosine 5’-(α, β-methylene) diphosphate (AMP-CP; Tocris) (0.5 mg/mouse ...
-
No products found
because this supplier's products are not listed.
Kazi Rahman, et al.,
bioRxiv - Immunology 2022
Quote:
22-(N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5-Cholen-3β-Ol-cholesterol (22-NBD-cholesterol) (N1148) and 7-NBD-PE (N360) were obtained from Thermo Fisher and dissolved in ethanol at 1 mM ...
-
No products found
because this supplier's products are not listed.
Wezley C. Griffin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... α-β-actin (Abcam, ab82227), 1:10,000 for two hours ...
-
No products found
because this supplier's products are not listed.
M. Nieves Calvo-Vidal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... HSP90 α/β (F-8, sc-13119, Santa Cruz), IMPDH2 (EPR8365B ...
-
No products found
because this supplier's products are not listed.
Natalia Armas-Capote, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Total and phosphorylated glycogen synthase kinase 3 (GSK3-β) were detected using rabbit antibodies anti-GSK3-β (9315) and anti-pGSK3α/β-Ser21/9 (9331) (Cell Signaling). Chemiluminescence signals were analyzed using Image Lab software 6.0 (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Ahmet Yetiman, Mehmet Horzum, Mikail Akbulut,
bioRxiv - Microbiology 2022
Quote:
... The AGA52 was grown in MRS broth (0.25% dextrose + 0.3% ox bile containing) supplemented with 100ppm cholesterol (5-cholesten-3β-ol (Sigma, Merck GmbH, Darmstadt, Germany), dissolved in 2-propanol ...
-
No products found
because this supplier's products are not listed.
Eugenia Zah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or TCR α/β (BioLegend #306704). EGFRt expression was measured with Erbitux (Bristol-Myers Squibb ...
-
No products found
because this supplier's products are not listed.
A. Daniels, et al.,
bioRxiv - Microbiology 2023
Quote:
... Hek-Blue IFN-α/β (InvivoGen) cells were maintained as monolayer cultures in complete DMEM supplemented with 30 µg/ml of blasticidin (Gibco ...
-
No products found
because this supplier's products are not listed.
Sylvia Varland, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 24 μL X-tremeGENE 9 DNA transfection reagent (Roche) and 500 μL Opti-MEM media (Gibco) ...
-
No products found
because this supplier's products are not listed.
Janne J. Mäkinen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 3’dGTP and cytidine-5’-[(α,β)-methyleno]triphosphate (CMPCPP) were from Jena Bioscience (Jena, Germany); 2’dGTP ...
-
No products found
because this supplier's products are not listed.
Emma K C Symonds, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... All samples (24 samples; 8 samples per macrophage polarization state) were cleaned (Supplementary Figure 3; FlowJo, version 10.7.1, BD), and live single cells were imported into OMIQ (Omiq.ai ...
-
No products found
because this supplier's products are not listed.
Sadhana Sharma, et al.,
bioRxiv - Neuroscience 2024
Quote:
8-9-week-old 3 male and 3 female rTg4510 mice were purchased from Jackson Labs, along with corresponding littermate controls ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
No products found
because this supplier's products are not listed.
Gabriel Sollberger, et al.,
bioRxiv - Immunology 2019
Quote:
... Recombinant murine cytokines (IL-3, IL-5, IL-9, GM-CSF, SCF) were from Peprotech.
-
No products found
because this supplier's products are not listed.
Felix M. Bennetts, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... [3H]-α,β-methylene ATP concentrations were checked on Tri Carb scintillation beta counters (PerkinElmer, USA). Data analysis was conducted using GraphPad Prism v9 ...
-
No products found
because this supplier's products are not listed.
Yuishin Kosaka, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
No products found
because this supplier's products are not listed.
Neeley Remmers, Mark A. Carlson,
bioRxiv - Cancer Biology 2021
Quote:
... 8-9 weeks old) were purchased from Charles River Laboratories ...
-
No products found
because this supplier's products are not listed.
Johanna Hol Fosse, et al.,
bioRxiv - Microbiology 2023
Quote:
... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
No products found
because this supplier's products are not listed.
Loreen Ruhm, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
No products found
because this supplier's products are not listed.
Ronnie Blazev, et al.,
bioRxiv - Biochemistry 2020
Quote:
... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
No products found
because this supplier's products are not listed.
Frank P. Assen, et al.,
bioRxiv - Immunology 2021
Quote:
... α- PDGFR-β (R&D Systems), α-YAP/TAZ (D24E4 ...
-
No products found
because this supplier's products are not listed.
Ashley Carey, et al.,
bioRxiv - Neuroscience 2023
Quote:
Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
No products found
because this supplier's products are not listed.
Cailin Xue, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Corning Costar Transwell 24-well plates (8 μm) (Corning, USA) were used to evaluate the migration and invasion ability of human HCC cell lines ...
-
No products found
because this supplier's products are not listed.
Tanner J. DuCote, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 8-9% fetal bovine serum (VWR, 97068-085). Remaining cells were resuspended in 1 ml of calcium/magnesium free PBS ...
-
No products found
because this supplier's products are not listed.
Filip Nemčko, et al.,
bioRxiv - Systems Biology 2024
Quote:
... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Elliot Ensink, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 8 mM DM-α-ketoglutarate (28394, Cayman Chemical), 5 μM CB-839 (22038 ...
-
No products found
because this supplier's products are not listed.
Vukasin M. Jovanovic, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 24- or 96-well plates or 8 chamber slides (Ibidi) were fixed using 4% PFA diluted in PBS for 15 min and washed 3 times with PBS (5 min each) ...
-
No products found
because this supplier's products are not listed.
Madison F. Walker, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ≥ 99% β+α was obtained from Anatrace (D310 5 GM). CHS (Cholesteryl Hemisuccinate Tris Salt ...
-
No products found
because this supplier's products are not listed.
Peter A. van der Ley, et al.,
bioRxiv - Immunology 2021
Quote:
(OlaHSD; Envigo, female, 8-9 weeks old at day 0) were immunized on day 0 and 21 via the intranasal or intramuscular route ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (9) Spin-coating SU-8 precursor (SU-8 2025, MicroChem) at 4000 rpm ...
-
No products found
because this supplier's products are not listed.
Sonica Chaudhry, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Caspase 8 and caspase 9 inhibitors were from Calbiochem, Merck ...
-
No products found
because this supplier's products are not listed.
Alexander Y. G. Yip, et al.,
bioRxiv - Microbiology 2023
Quote:
... with the addition of a bead beating step for 3 minutes at speed 8 in a Fast-Prep 24 bead beater (MP Biomedicals, USA). DNA was stored at −80°C until it was ready to be used.
-
No products found
because this supplier's products are not listed.
Yuxin Hao, et al.,
bioRxiv - Cell Biology 2024
Quote:
cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
No products found
because this supplier's products are not listed.
Laura Giorgi, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC) and Ergosta-5,7,9(11),22-tetra-3beta-ol (dehydroergosterol, DHE) were purchased from Avanti Polar Lipids Inc (Alabaster ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Claire D. McWhite, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Samples were separated into 24 fractions using the 24 cm IPG strips pH 3-10 NL (GE HealthCare, Chicago, IL). To achieve the required low salt concentration 2.5 mg wheat germ extract was diluted with water and centrifuged 10 min. ...
-
No products found
because this supplier's products are not listed.
Kristen R. Farley, et al.,
bioRxiv - Microbiology 2024
Quote:
... and 40 μg/ml 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) (GoldBio).
-
No products found
because this supplier's products are not listed.
Flora Magnotti, et al.,
bioRxiv - Immunology 2021
Quote:
... 20H (5-β-pregnan-3-α-ol, #P7800-000), Sulphate (5β- pregnan-3α-ol-20-one sulphate, sodium salt, #P8168-000) were from Steraloids. Tetrahydrocortisol (#T293370 ...
-
No products found
because this supplier's products are not listed.
Takuma Shibata, et al.,
bioRxiv - Immunology 2022
Quote:
... Mouse IFN-α and IFN-β concentrations in the supernatant were measured using IFN-α/β ELISA kits (PBL Assay Science, USA).
-
No products found
because this supplier's products are not listed.
Karen. M. Marshall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 5- 10 mL alpha-Minimum Essential Medium (α-MEM, Lonza, UK) or Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Yusuke Ohno, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-Hexyn-1-ol (500 μL, 4.53 mmol; Tokyo Chemical Industry, Tokyo, Japan) was added dropwise to a mixture of Dess-Martin periodinane (2.50 g ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
Lisa G.M. van Baarsen, et al.,
bioRxiv - Immunology 2021
Quote:
... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ...
-
No products found
because this supplier's products are not listed.
Sabrina Asteriti, et al.,
bioRxiv - Neuroscience 2022
Quote:
... digitized at 5 kHz and acquired with pClamp 9 (Molecular Devices). Electrophysiological records were analyzed in Axograph X with automated custom scripts ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Elisa Redl, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Methylene blue staining (0.02% methylene blue in 0.3M sodium acetate) was used for an internal DNA loading control ...
-
No products found
because this supplier's products are not listed.
Oumeng Zhang, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1.5 NA TIRF objective lens (OL, Olympus UP-LAPO100XOHR) and an achromatic tube lens (TL ...
-
No products found
because this supplier's products are not listed.
Paula Chlebanowska, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Glass micropipettes were fabricated from borosilicate glass capillaries (8-9 MΩ; Sutter Instruments) with the use of a horizontal puller (Sutter Instruments ...