Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: 22-(N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5-Cholen-3β-Ol-cholesterol (22-NBD-cholesterol) (N1148) and 7-NBD-PE (N360) were obtained from Thermo Fisher and dissolved in ethanol at 1 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... differentiated OLs at 6 DIV (‘OL 3 days’) were transfected with plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Triethylamine and 5-hehyn-1-ol 97% were purchased from Acros Organics (Geel, Belgium). Deuterium oxide (D2O ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Plant Biology 2022Quote: The stock solutions for the GLVs (Z)-3-hexen-1-ol (Z3-HOL, 98%; Acros Organics) and (Z)-3-hexenyl acetate (Z3-HAC ...
-
bioRxiv - Immunology 2019Quote: ... IFN-α and IFN-β levels were measured using IFN-α/IFN-β 2-Plex Mouse ProcartaPlexTM Luminex Panel (Invitrogen).
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit α-β-Gal (RRID:AB_221539; Invitrogen; 1:500). Alexa fluor 488 ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2021Quote: ... which was boiled in the SDS loading buffer with 5% β-mercaptoethanol (Cat. #60-24-2, Acros Organics). The denatured protein samples were separated by Novex™ WedgeWell™ 4-20% SDS-PAGE Tris-Glycine gel and transferred to PVDF membrane (iBlot™ 2 Transfer Stacks ...
-
bioRxiv - Microbiology 2020Quote: ... 24 mL 5% NaHCO3 (Gibco) and 340 ml water ...
-
bioRxiv - Neuroscience 2023Quote: ... after which 9 ml Essential 8 medium (Thermo Fisher Scientific, A1517001) was added to the well for resuspension ...
-
bioRxiv - Neuroscience 2020Quote: ... TNF-α (BMS607-3, Thermofisher Scientific), C1q (LS-F55223-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... in chloroform/methanol/propan-2-ol (Thermofisher Scientific) (1:2:4 V:V:V ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 8·9 μL of nuclease-free water (Thermo Scientific, Waltham, MA, USA). Amplifications were performed with 30 seconds of 98□ for initial denaturation ...
-
bioRxiv - Immunology 2023Quote: Transwell inserts for 24-well plate (8 µm pore size, Nunc) were used and 250 µl of media containing chitinase-digested chitin flakes ...
-
bioRxiv - Microbiology 2021Quote: ... and 2×105 cells were seeded into 24-well culture plates or 5×104 cells into Lab-Tek II 8-well chamber slides (Nunc/Thermo Fisher). To account for donor variations ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-8% Tris-Acetate gels (Invitrogen EA0375) were used to resolve all proteins ...
-
bioRxiv - Molecular Biology 2019Quote: ... separated in Nupage® 3-8% (Invitrogen) polyacrylamide gels and blotted on PVDF membranes using the Trans-Blot® Turbo™ system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3–8% Tris-acetate gels (Life Technologies. Proteins were transferred to nitrocellulose membrane by semi-dry transfer (Trans-Blot Turbo transfer system ...
-
bioRxiv - Cell Biology 2022Quote: ... or 3-8% Tris Acetate (Invitrogen, EA0375) polyacrylamide gels ...
-
bioRxiv - Cancer Biology 2023Quote: ... run on 3-8% gel (NuPAGE, Invitrogen) and probed using BRCA1 (Santa Cruz ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3-8% Tris-Acetate (Invitrogen EA03785) polyacrylamide gels for Coomassie stain (Instant Blue Abcam AB119211 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 3-8% Tris-Acetate gels (Invitrogen) and transferred onto PVDF membranes using a wet blot system for 1 h at 100 V (Biorad) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 and 9 μg respectively using Lipofectamine 2000 (Thermo Fisher, 11668027). Infectious supernatant was collected at 48 and 72 hours after transfection and filtered to remove cell debris ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 was performed using a QuantStudio™ 3 (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... and TNF-α were quantified using a 9-plex Procartaplex assay (PPX-09, Thermo Scientific). In short ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Thermo Fisher Scientific) and immunoblotted as described above.
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Thermo Fisher Scientific) and immunoblotted as described above.
-
bioRxiv - Microbiology 2021Quote: ... and 2×105 cells were seeded into 24-well culture plates or 5×104 cells into Lab-Tek II 8-well chamber slides (Nunc/Thermo Fisher). To account for donor variations ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... and ProcartaPlex mouse IFN-α/IFN-β 2-plex (ThermoFisher, EPX02A-22187-901) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was diluted in methylene chloride (Optima grade, Fisher Scientific) to a concentration of 22.5 picomole/µL to determine the transition ions to be used in the single-reaction monitoring (SRM ...
-
bioRxiv - Cell Biology 2023Quote: ... IL-8 and TNF-α were measured using ELISA kits from Invitrogen (Catalog# BMS224-2 ...
-
bioRxiv - Immunology 2023Quote: ... or APC-α-mouse CD14 primary antibody (clone Sa2-8; Thermo Scientific) on ice in the dark for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... R 5’-atggatccTCATAGAGCTGAAGCCACCAG-3’) were generated by PCR amplification from 24 hpf whole embryo cDNA and cloned to pCRII-TOPO (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... or NuPAGE 3-8% Tris-Acetate Gels (Invitrogen) and transferred to Immun-Blot PVDF membrane (Bio-rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 3-8% Tris-Acetate gels (Thermo Fisher) for gel electrophoresis depending on the protein sizes of interest ...