-
Cat# ACT-PALM-24B,
USD $56.67/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Mei Hong Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... or 9 U Isopol SD+ (ArcticZymes). Reaction temperatures and times for these polymerases were ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Kayla Glockzin, Thomas D Meek, Ardala Katzfuss,
bioRxiv - Biochemistry 2021
Quote:
... 9-deazaadenine was purchased from AA blocks (AA0037QI). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
No products found
because this supplier's products are not listed.
Stephen B. Rigoulot, et al.,
bioRxiv - Plant Biology 2019
Quote:
... and a 524 ± 24 nm (FF01-524/24, IDEX Health & Science, LLC., Rochester, NY) was mounted onto the 523 nm diode ...
-
No products found
because this supplier's products are not listed.
Sunny Sharma, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 25 μg of cleaved RNA was separated by electrophoresis on 8% urea polyacrylamide gels supplemented with 0.3% 3-acrylamidophenylboronic acid (Boron Molecular). RNA was transferred to positively charged Nylon transfer membrane (GE Healthcare Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Aditya Arora, et al.,
bioRxiv - Cell Biology 2020
Quote:
The fabricated micro-hydrogels after culture for 24 hours were suspended in hydrogel precursor solution containing Hyaluronic acid-tyramine (5 mg/ml) (LifeCore Biomedical), collagen (0.5 mg/ml ...
-
No products found
because this supplier's products are not listed.
Alejandro A. Pezzulo, et al.,
bioRxiv - Genomics 2021
Quote:
... quenching of endogenous peroxidase (3% hydrogen peroxide, 8 minutes) and blocking of nonspecific stain (Background Buster x 30 minutes, Innovex Biosciences, Richmond, CA, USA). A mouse monoclonal anti-p63 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Fabrizio Clarelli, et al.,
bioRxiv - Biochemistry 2019
Quote:
... GyrB (Rabbit α-Gyrase B, PB005, Inspiralis), and CRP (Mouse α-E ...
-
No products found
because this supplier's products are not listed.
Keren Zhou, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 24 h by spiral plating (easySpiral, Interscience) 10-fold dilutions onto MHB agar ...
-
No products found
because this supplier's products are not listed.
Shivnarayan Dhuppar, Aprotim Mazumder,
bioRxiv - Cell Biology 2019
Quote:
... DNA hybridization mixture was prepared: 9 µl hybridization buffer (from Empire Genomics) + 1 µl probes ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
Peptide to ACTH (3-24) (Human)
Cat# CCP1854,
1 mg USD $229.0, 5 mg USD $573.0, 10 mg USD $859.0
Ask
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020 ...
-
No products found
because this supplier's products are not listed.
Steven A Kemp, et al.,
bioRxiv - Microbiology 2021
Quote:
... 9 DNA fragments with overlap sequences were amplified by PCR from a plasmid (phCMV1, Genlantis) encoding the full-length SARS-CoV-2 S gene (BetaCoV/Wuhan-Hu-1/2019 ...
-
No products found
because this supplier's products are not listed.
Fabrizio Clarelli, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and CRP (Mouse α-E. coli CRP, 664304, Nordic Biosite antibodies) were diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
John Grizzanti, et al.,
bioRxiv - Neuroscience 2022
Quote:
Plasma insulin levels of 9-month-old animals were measured via mouse ultra-sensitive insulin ELISA (ALPCO,) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Tuan Minh Tran, et al.,
bioRxiv - Plant Biology 2020
Quote:
... we used α-GFP antibody (1:200; Torrey Pines BioLabs, NJ, U.S.A) to probe for the FLS2-GFP in FLS2-GFP transgenic plants ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
Cat# NSC,
USD $119.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Randall S. Carpenter, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 24-72 hour postnatal NSG pups received 100cGy whole body irradiation (RS 2000, Rad Source, Suwanee, GA), followed immediately by engrafting 1-5×104 human umbilical cord CD34+ stem cells (Lonza Incorporated ...
-
No products found
because this supplier's products are not listed.
Benjamin L. Woods, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cells were grown to mid-log phase at 24°C in Complete Synthetic Medium (CSM, Sunrise Science Products) supplemented with 0.67% yeast nitrogen base ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Tiannan Guo, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Each of 24 fraction was recovered and cleaned up by C18 reversed-phase MicroSpin columns (The Nest Group Inc.). Based on the sample complexity (based on Nanodrop ...
-
No products found
because this supplier's products are not listed.
Eugene Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and for acute phase protein α-2-macroglobulin using an ELISA kit (Life Diagnostics Inc., West Chester, USA).
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
IL31, also known as interleukin-31, is a cytokine with an anti-parallel four-helix bundle...
Cat# IL31-05D,
10ug : USD $198
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...