Labshake search
Citations for Roche :
1 - 50 of 2467 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 24 μL X-tremeGENE 9 DNA transfection reagent (Roche) and 500 μL Opti-MEM media (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ATP sodium salt and α,β-meATP were purchased from Roche Diagnostics (Mannheim ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2023Quote: ... grown for 24 hours and transfected with 8 μg of plasmids and 8 μl of X-tremeGENE HP DNA Transfection Reagent (Roche). The cells were grown for 48 hours post-transfection and collected for downstream analyses.
-
bioRxiv - Genetics 2021Quote: ... 5 mM β-mercaptoethanol supplemented with protease inhibitors (Roche), 1mM PMSF ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM β-mercaptoethanol and protease inhibitor cocktail (Roche) for 1 h at 4℃ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM β-ME) plus cOmplete protease inhibitor (Roche) and lysed by three 15K psi passes on an Avestin Emulsiflex ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Physiology 2022Quote: ... In each reaction 50 ng luciferase reporter and 150 ng expression vectors were transfected into C2C12 myoblasts in 24-well plates (50,000 cells per well) using X-tremeGENE 9 (Roche). 5 ng modified pRL null plasmid (25 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid minigenes were transfected 24 h after cell seeding using X-tremeGENE 9 DNA Transfection Reagent (Roche; Mannheim, Germany). HepG2 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM β-mercaptoethanol supplemented with protease inhibitor cocktail (Roche). Cell lysis was accomplished by sonication ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5%β-mercaptoethanol) supplemented with Complete Protease Inhibitor Cocktail (Roche) and PhosSTOP Phosphatase Inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The probes for the upstream regions of the pks1 (oligonucleotides 9 and 10) and ku80 (oligonucleotides 24 and 25) deletion constructs were synthetised using PCR DIG DNA Labeling Mix (Roche) and Taq DNA Polymerase (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μCi of α-32P-[ATP] and α-32P-[UTP] and 20 U of T7 RNA Polymerase or SP6 RNA Polymerase (Roche Applied Sicences). The reaction was incubated for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM β-mercaptoethanol and protease inhibitors (cOmplete, Roche, Basel, Switzerland) and lysed mechanically using EmulsiFlex (Avestin ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM β-ME) with complete EDTA-free protease inhibitor (Roche). The cells were lysed by sonication (Vibra-Cell™ VCX 130 ...
-
bioRxiv - Neuroscience 2020Quote: ... 100mg of frontal cortex tissue (Brodmann area 8/9) were thawed and homogenized in 500μl of PBS with protease inhibitor (Roche) by 30 up and down strokes in a glass Dounce homogenizer ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... Then qPCR was performed in triplicate using 4 μl sample in 8-9 μl reaction with FastStart Universal SYBR Green Master Mix (Roche) and primers flanking each MseI cassette (Table S3).
-
bioRxiv - Biochemistry 2021Quote: ... Transfection with full-length nV5-WT or nV5-P112L (0.8 μg DNA/well) was performed 24 h post-seeding using X-tremeGENE™ 9 DNA Transfection Reagent (Roche, Basel, Swityerland). 24 h post-transfection ...
-
bioRxiv - Systems Biology 2019Quote: ... 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Roche, A32965), and 3 volumes 0.1 mm Zirconia beads (Thistle Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM β-mercaptoethanol (buffer A) with Complete protease inhibitor cocktail (Roche) and 2 mg DNAse I from bovine pancreas (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Cell Biology 2022Quote: ... X-tremeGENE 9 (Roche) for sgRNA transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Xtreme gene 9 (Roche) reagent was used according to manufacturer’s recommendations for transient transfections.
-
bioRxiv - Cell Biology 2023Quote: ... XtremeGene 9 (Roche Diagnostics) was used.
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...