Labshake search
Citations for Bio-Rad :
1 - 50 of 2366 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Cell Biology 2023Quote: ... concentration was fixed at 5% while N,N-methylene-bis-acrylamide (bis, Bio-rad) varied from 0.04% to 0.1% to attain different stiffnesses of the substrates ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of desired elasticities with a Poisson’s ratio of 0.5 ...
-
bioRxiv - Immunology 2019Quote: ... and N,N-methylene-bisacrylamide (Bio-Rad) to achieve the range of elasticity ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dried pellets enriched for histones were dissolved in sample buffer (8 M urea, 5% β-mercaptoethanol and 10 mM Tris-HCl (pH 7.0)) and added sample loading buffer (Biorad XT sample buffer ...
-
bioRxiv - Biophysics 2019Quote: ... N-methylene-bis-acrylamide (Bio-Rad, Herculers, USA) are added ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by 3-8% or 8-16% SDS-PAGE (NU-PAGE or BioRad) and transferred to immobilon-P membranes (Millipore) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed and stained for β-actin (cyan) and tubulin-α (magenta; BioRad MCA78G). Arrows in merge highlight TNTs ...
-
bioRxiv - Cell Biology 2020Quote: ... n,n’-methylene-bis-acrylamide (BIORAD, 2% w/v stock solution), N-6-((acryloyl)amino)hexanoic acid crosslinker (N6 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Neuroscience 2022Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules ...
-
bioRxiv - Molecular Biology 2020Quote: ... carried out in glass tubes filled with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (Bio-Rad, USA) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Electrofocusing was performed in glass capillaries with polyacrylamide gel using a mixture of ampholytes 3/10 and 5/8 (#163-1112, #163-1192, Bio-Rad, USA). The second direction is standard SDS 5-10% PAGE followed by staining with Coomassie Brilliant Blue G-250 (#31-4-58-1 ...
-
bioRxiv - Immunology 2024Quote: ... TNF-α) were analyzed using Bio-Plex Pro Mouse Cytokine 8-plex Assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Biophysics 2020Quote: ... using a 9 × 9 mm2 frame seal (SLF0201, Biorad). The chamber was plasma-treated to improve wettability ...
-
bioRxiv - Microbiology 2022Quote: ... containing a final concentration of 5% β-mercaptoethanol (Bio-Rad #1610710). Cell lysates were then denatured at 95°C for 10 min ...
-
bioRxiv - Genomics 2020Quote: ... were seeded per well in 6-well plates (2 ml per well). 24 hrs later cells were transfected with siRNA (Supp. Table 9) using SilentFect (Bio-Rad) in biological triplicates ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were replenished with compounds every 24 h and counted on days 1-9 using automated cell counter (Bio-Rad). KYSE-520 cells were plated onto 96-well plates (500 cells per well ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules, CA) were then secured to a coverslip ...
-
bioRxiv - Biophysics 2022Quote: ... Frame-seal slide chambers (9 × 9 mm, Bio-rad, USA) were affixed to the glass coverslips ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Biophysics 2021Quote: ... Frame-seal slide chambers (9 x 9 cm2, Bio-Rad, Hercules, USA) were affixed to the glass ...
-
bioRxiv - Cell Biology 2020Quote: ... 5%β-mercaptoethanol) and migrated on 4-15% Tris-glycine gradient gels (BioRad).
-
bioRxiv - Immunology 2021Quote: ... clone AT152-9 (BioRad). To aggregate FcγRIIA ...
-
bioRxiv - Microbiology 2024Quote: ... 9 µm (Bio-Rad) with isocratic mobile phase 0.005 mol L−1 H2SO4 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Genomics 2024Quote: ... with CHEF DNA 8-48 kb and CHEF DNA 5 kb (BioRad) size standards ...
-
bioRxiv - Physiology 2019Quote: ... and blocked for 24 hours at 4°C in 5% blotting-grade blocker (BioRad). Blots were incubated in primary OXPHOS antibody (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Frame-Seal slide chambers (9 x 9 mm2, Biorad, Hercules, USA, SLF-0601) were affixed to the glass and 50 µL of poly-L-lysine (70k-150k molecular weight ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Microbiology 2019Quote: ... caspase-9 and caspase-3 was done using a CFX-96 real-time PCR system (BioRad, Hercules, CA, USA). The reaction mixture for each sample carried 2 µL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...