Labshake search
Citations for Merck :
1 - 50 of 2009 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The AGA52 was grown in MRS broth (0.25% dextrose + 0.3% ox bile containing) supplemented with 100ppm cholesterol (5-cholesten-3β-ol (Sigma, Merck GmbH, Darmstadt, Germany), dissolved in 2-propanol ...
-
bioRxiv - Molecular Biology 2023Quote: Reference standards Histamine and Histamine-α,α,β,β-d4 were purchased from Merck and Toronto Research Chemicals ...
-
bioRxiv - Physiology 2020Quote: ... Sections were stained with methylene blue (Loeffler’s Methylene blue solution; Merck) for 45 s at 80 °C and alizarin red (Alizarin red S staining solution ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5% β-mercaptoethanol (Merck; M6250). Subsequently ...
-
bioRxiv - Biochemistry 2023Quote: ... and 188 μM L-α-phosphatidylcholine: L-α-phosphatidylinositol PC:PI (3:1) (Merck, Darmstadt, DE). 1.5 ml of 0.1 M potassium phosphate buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dimethyl methylene blue (DMMB; pH 1.8; Sigma-Aldrich, Merck) was applied to the cultures ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% glycerol and 5 mM β-mercaptoethanol) with 0.4 mM Pefabloc (Merck), were disrupted by sonication ...
-
bioRxiv - Microbiology 2022Quote: ... α: β: γ: δ = 1:1:1:1 was obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: ... the cells were stimulated with IFN-β (1,000 U/ml, 8 h, Merck), IFN-a2 (500 U/ml ...
-
bioRxiv - Physiology 2022Quote: ... stained with May-grunwald’s eosin-methylene blue solution modified (Merck) for 3 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... or with 5 μg/ml α-amanitin (Merck, A2263) as indicated in the text.
-
bioRxiv - Biophysics 2022Quote: ... and 5 mg/mL α-casein (Merck, Darmstadt, Germany) (7 ...
-
bioRxiv - Genetics 2023Quote: ... 5% CO2 and transfected using the Xtreme Gene 9 transfection reagent (Merck) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 9-β-D-Ribofuranosyladenine (adenosine) and (S)-(+)-a-amino-4-carboxy-2-methylbenzeneacetic acid (LY-367385) were purchased from Merck.
-
bioRxiv - Microbiology 2022Quote: ... mouse α-c-Myc antibodies (2.5 to 5 µg/ml; Merck), or mouse α-CSP 3D11 monoclonal antibodies (6 ...
-
bioRxiv - Zoology 2020Quote: ... blood smears were stained using a May-Grunwald eosin methylene blue solution (Merck-Millipore catalog number 10142401251730) ...
-
bioRxiv - Zoology 2020Quote: ... blood smears were stained using a May-Grunwald eosin methylene blue solution (Merck-Millipore catalog number 10142401251730) ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Sheared chromatin was incubated with 10 µg of α-H4.V or 5 µg of α-H4K5Ac (Merck 07-327) or 4 µg of α-H4 (Abcam ab10158 ...
-
bioRxiv - Cell Biology 2022Quote: ... milk powder before incubation in primary and HRP-secondary antibodies (α-globin, sc-514378; β-globin, sc-21757; γ-globin, sc-21756 [Santa Cruz]; β-actin, A1978 [Merck]; BCL11A, ab19487 [Abcam]). Bands were visualized using enhanced chemiluminescence (G.E ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The LRP1 α-chain (515 kDa) and β-chain (85 kDa) were detected using antibodies 8G1 (2μg/mL) (Merck-Millipore) and 5A6 (2μg/mL ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1% β-mercaptoethanol (Cat N° 31350010)) supplemented with 5 μM Y-27632 (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Bioengineering 2021Quote: Inflammatory stimulations were performed by treating the chips for 24 h from d4-d5 or d11-d12 with TNF-α (final concentration of 20 ng/mL; SRP3177; Merck KGaA) or LPS (final concentration of 100 ng/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... Pure standards of (Z)-3-hexenyl acetate (Z3HAC, 98 %, CAS number 3681-71-8, Merck) was used in different concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Immunology 2021Quote: ... and 50 µm β-Mercaptoethanol (β-ME; Merck), washed once ...
-
bioRxiv - Microbiology 2020Quote: ... Morphologically different colonies were sub-cultured on sterile Eosin Methylene Blue differential agar (EMB) (Merck, Darmstadt, Germany) and incubated at 37 °C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were stained with 1 mL 10% Giemsa’s azur eosin methylene blue solution (Merck KgaA, Darmstadt, Germany) in milli-Q water for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 24×50 mm high-precision coverslips (no. 1.5H; Marienfeld) were cleaned in Piranha solution (3:1, 98% H2SO4 (Merck):30% H2O2 (Sigma-Aldrich) ...