Labshake search
Citations for Agilent :
1 - 50 of 1546 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Genomics 2019Quote: OLS libraries (Agilent Technologies, Santa Clara, CA) were resuspended to a final volume of 200 nM in TE pH 8.0 (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... We then ordered the following oligo library (OL) from Agilent: 100k oligos (Extended Data Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Synthetic Biology 2022Quote: To assemble an oligonucleotide Library Synthesis (OLS) Pool (oligo pool; Agilent) into an AAV genome ...
-
bioRxiv - Genomics 2022Quote: ... we took advantage of an improved HiFi OLS platform from Agilent, which led to reduced error rates such that 80% of our final Kir2.1 variants consist only of our designed mutations.
-
bioRxiv - Plant Biology 2021Quote: Purified α(β)-CBD was checked by GC-MS (Agilent 7895A-5975C, USA). Chromatographic conditions were ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... TCR α and β chains were expressed in BL21 (DE3)-RIPL Escherichia coli cells (Agilent Technologies) following induction with 0.15 mM IPTG ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Biochemistry 2019Quote: ... OCR and ECAR were measured 3 times every 9 minutes using a XFe96 Analyzer (Seahorse Bioscience) at a baseline and after addition of each drug ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B ...
-
bioRxiv - Cell Biology 2023Quote: ... TMEM24(ΔBS + 5S → E)-eGFP was generated using site-directed mutagenesis to remove a portion of the C-terminus of TMEM24(5S → E)-eGFP including the first 3 β-strands of the β-sheet band 4.1 interacting domain (Quik-Change II XL; Agilent Technologies).TMEM24(5S → E)-eGFP which has been previously described (Sun et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH 9 (Dako) and endogenous peroxidase activity was blocked using 3% hydrogen peroxide ...
-
bioRxiv - Synthetic Biology 2019Quote: ... we synthesized a microarray-derived oligo library synthesis (OLS) pools of 33,792 230mer oligos from Agilent Technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent S2367). The chamber was heated to 125 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 9 (both Dako), endogenous peroxidase activity was blocked using 3% hydrogen peroxide and sections were blocked in PBS with 10% FBS (blocking buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (Agilent, #S2375) were heated to 97 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent, S2367) for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent, S2367). 400µl/slide of primary antibody was incubated on slides overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 9 (Dako, S2367) at 115°C for 15 minutes in a pressure cooker for antigen retrieval ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 9 (Dako, S2367) with a pressure cooker for 20 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... Volatiles were eluted in methylene chloride and analyzed using GC-MS (GC: Agilent 7890B, MS: Agilent 5977B ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 solution (Dako, S2367) in a pressure cooker at 125°C for 15 minutes ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...