Labshake search
Citations for Lonza :
1 - 50 of 602 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 5- 10 mL alpha-Minimum Essential Medium (α-MEM, Lonza, UK) or Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-10 mL alpha-Minimum Essential Medium (α-MEM, Lonza, UK) or Dulbecco’s Modified Eagle Medium (DMEM ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Keratinocytes were seeded in 12-well plates and stimulated with 10 ng/ml IL-17 or with a combination of 200 U/ml interferon (IFN)-γ and 50 ng/ml TNF-α or with the three cytokines together for 24 hours in keratinocyte basal medium (KBM, Lonza). Supernatants were collected ...
-
bioRxiv - Biophysics 2021Quote: ... The WT and mutant genes were then amplified from these expression plasmids using the PCR primers 5’-GCGCTAGCAGCACCCATATGCCTGAG-3’and 5’-ACGAAGCTTTCAGTGGTGGTGGTGGT-3’and subcloned into the pMaxCloning vector (Lonza, VDC-1040) via NheI and BamHI sites to generate the pMax_WT_NEIL1 and pMax_Mutant_NEIL1 expression plasmids that were utilized throughout this analysis.
-
bioRxiv - Cancer Biology 2019Quote: All tumouroids were fabricated using monomeric Type I rat-tail collagen (First Link, Birmingham, UK) and the RAFT™ protocol pages 8-9 (Lonza, Slough, UK) as previously described21 ...
-
bioRxiv - Genomics 2022Quote: ... donors (passage 4-9; Lonza) were grown in complete Endopan-3 medium kit (PAN-Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2020Quote: Bone marrow cells were extracted from long bones of C57BL/6J mice 6 to 8 weeks of age as described (Guimbal et al.. 2019) and cultured in α-minimal essential medium (αMEM. Lonza) containing 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... Adipose-derived stem cells (Passage 3-5) (Lonza, Walkersville, MD, USA) were cultured in a basal medium consisting of DMEM/F12 ...
-
bioRxiv - Bioengineering 2021Quote: ... were used between passages 3-5 for paxillin experiments and culture medium was changed every 2-3 days (Lonza FBM Basal Medium supplemented with 2 v/v% fetal bovine serum (FBS) ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2023Quote: Drosophila ovaries (5-8 pairs per sample) were dissected into room temperature Grace’s insect medium (Lonza). Ovaries were fixed for 10 min using 4% paraformaldehyde diluted in Grace’s medium ...
-
bioRxiv - Bioengineering 2020Quote: ... passage 3-5 AFC were dissociated and resuspended in EGM-2 (Lonza) at 4×105 cells/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... program A-24 (Lonza). 1.0μg pSIN4-EF2-O2S and pSIN4-EF2-N2L were used for each electroporation ...
-
bioRxiv - Cell Biology 2019Quote: ... hMSCs were cultured in α-minimum essential medium (α-MEM; Lonza) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... using antibiotic-free endothelial media and were lifted for seeding at passage 5-8 (Lonza, Walkersville, MD). After lifting ...
-
bioRxiv - Microbiology 2022Quote: ... EMEM (ATCC; MRC-5 and Calu-3 cells) (Lonza; Tb-1 Lu cells) or MEM (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Microbiology 2022Quote: ... pH 8 (Lonza), stained with SyberGreen (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 × 105 cells were electroporated using 5 mg of total DNA (Ratio 1:1) and the Amaxa Nucleofector kit (Lonza) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... all cells were cultured at 37°C in a humidified 5% CO2 incubator in minimum essential medium Eagle α (Lonza; BE12-169F) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... in α-MEM (Lonza, Basel, Switzerland) supplemented with 5% GMP-grade human platelet lysate (PL ...
-
bioRxiv - Cancer Biology 2021Quote: ... filled with α-MEM medium (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... Between 1×10^3 – 5×10^4 cells were re-suspended in 20μl Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the CRISPR/Cas9 gRNA RNP complex ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Physiology 2020Quote: ... Differentiation media consisted of α-MEM (Lonza), 1% hiFBS ...
-
bioRxiv - Neuroscience 2022Quote: ... The 24-well Dipping Electrode Array (Lonza Bioscience) was carefully placed onto the 24-well culture plate avoiding air bubbles ...
-
bioRxiv - Bioengineering 2022Quote: ... 24-well RAFT™ absorbers (Lonza, Slough, UK) were used to plastic compress them for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... supplemented with 8 mM L-Glutamine (Lonza) and 1 μL per mL anti-clumping agent (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... [70] for 24 hours in reduced medium (basal EBM2 (Lonza) supplemented with Gentamicin ...
-
bioRxiv - Biochemistry 2023Quote: ... 24 h prior to transfection with an Amaxa nucleofector (Lonza) using programme Z-001 ...
-
bioRxiv - Genomics 2023Quote: ... Both vectors were also transfected as background controls (1 µg) with pmaxGFP (9 µg, Lonza). 24 hours post nucleofection ...
-
bioRxiv - Cell Biology 2020Quote: ... Min6 β-cells were transfected using an Amaxa Nucleofector (Lonza) as previously described (13) ...
-
bioRxiv - Bioengineering 2019Quote: ... and 8 mM L-glutamine (Lonza, Basel, Switzerland). Fed-batch cultivation was performed in a DASGIP Mini bioreactor (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: An 8% SeaPlaque GTG Agarose (Lonza, Basel, Switzerland) solution in Ultra Pure Water (Genesee Scientific ...
-
bioRxiv - Immunology 2022Quote: ... 24 mM Sodium Succinate) using Amaxa™ 4D-Nucleofector™(Lonza). Electroporated B cells were culture in 200ul primary B cell medium for 6 days.
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biochemistry 2022Quote: ... Exponentially growing Spodoptera frugiperda 9 cells (2E06 cells/mL in Lonza Insect-XPRESS medium #BELN12-730Q) were infected with high-titer Baculovirus suspension ...
-
bioRxiv - Cancer Biology 2020Quote: ... OCI-AML2 and OCI-AML3 were cultured in MEM-α (Lonza) with 20 % FBS and 1 % GlutaMax (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...